View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_2 (Length: 542)

Name: NF1856_high_2
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_2
NF1856_high_2
[»] chr3 (1 HSPs)
chr3 (13-526)||(55102962-55103475)


Alignment Details
Target: chr3 (Bit Score: 490; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 490; E-Value: 0
Query Start/End: Original strand, 13 - 526
Target Start/End: Complemental strand, 55103475 - 55102962
Alignment:
13 aatatcattgaatggaatgtaagaaattaccttggatcccaagagtcgaaagtttagtgctattgaagctgtaagttgttgccttttggttaaaaccagg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55103475 aatatcattgaatggaatgtaagaaattaccttggatcccaagagtcgaaagtttagtgctattgaagctgtaagttgttgccttttggttaaaaccagg 55103376  T
113 atgttgaacgagcacgttccagttagagtagtttctattgaagttgtagttagaaattgtaagcttgaccccccattgattcatataattgttcttgaaa 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
55103375 atgttgaacgagcacgttccagttagagtagtttctattgaagttgtagttagaaattgtaagcttgatcctccattgattcatataattgttcttgaaa 55103276  T
213 tgccaatggactcgaattggacacatgtggtcggtacattcaattatatttttctcatcatttgaccctcccagaggatcacctggcctggttacttaat 312  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55103275 tgccaatggactcgaattggacacatgtggtcagtacattcaattatatttttctcatcatttgaccctcccagaggatcacctggcctggttacttaat 55103176  T
313 aattagcagtaagcacacaactgtagacatattaatgacattaatgaaaaaacacgaatgttcgagcaaatgaaataacatgcaccttatgcaagacagt 412  Q
    | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55103175 atttagcagtaagcacacaacagtagacatattaatgacattaatgaaaaaacacgaatgttcgagcaaatgaaataacatgcaccttatgcaagacagt 55103076  T
413 gaatttttatttgcttccctgcatccaccacaagtgcaattacggcatggtgtgatgataggattgtaaaatgttgagaatgaaacacagcatactggtg 512  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
55103075 gaatttttatttgcttccctgcatccaccacaagtgcaattacggcatggtgtgatgataggattgtaaaatgttgagaacgaaacacagcatactggtg 55102976  T
513 acttgtttgctaag 526  Q
    ||||||||||||||    
55102975 acttgtttgctaag 55102962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 29941 times since January 2019
Visitors: 1588