View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_21 (Length: 212)

Name: NF1856_high_21
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_21
NF1856_high_21
[»] chr3 (4 HSPs)
chr3 (12-202)||(53498819-53499009)
chr3 (12-202)||(53491223-53491415)
chr3 (20-108)||(16069999-16070087)
chr3 (25-63)||(53516478-53516516)
[»] chr7 (1 HSPs)
chr7 (23-96)||(45355367-45355440)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 53499009 - 53498819
Alignment:
12 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53499009 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 53498910  T
112 gttgttgctcttatattctcacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53498909 gttgttgctcttatattctcacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 53498819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 53491415 - 53491223
Alignment:
12 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 111  Q
    |||||| |||||||||||| |||||| ||||||| ||||||||||||||||||||| |||||| |||||||| |||||| |||||||||||||||||| |    
53491415 ctgaaaggaagtattctgattgggaattgaaaggtgtccctctaaggattgaaattgggccaaaggatttagtaaataagcaggttatctatgttgtctt 53491316  T
112 gttgttgctcttatattct--cacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 202  Q
    |||||||||||||||||||  || ||||||||||||||||||  | |||||||||||||| ||||||||||||||||||||||| ||||||||    
53491315 gttgttgctcttatattcttacatatgtcattttgcttctactgtttatgttcaatgagataccaaataaatcacttcaatttttcacaggtt 53491223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 16070087 - 16069999
Alignment:
20 aagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgt 108  Q
    |||||||||||||||||||||||||| |||||| ||| | |||||||| ||| || || ||||| |||||| ||||||||  |||||||    
16070087 aagtattctgaatgggaaatgaaaggtgtccctttaatggttgaaattgggctaaagggtttaggaaataagcaggttattaatgttgt 16069999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 53516516 - 53516478
Alignment:
25 ttctgaatgggaaatgaaaggcgtccctctaaggattga 63  Q
    ||||||||||||||||||||| |||||||||||||||||    
53516516 ttctgaatgggaaatgaaaggtgtccctctaaggattga 53516478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 45355367 - 45355440
Alignment:
23 tattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggt 96  Q
    |||||| | |||||||||||||| || |||||||||||||||||  |||| | |||||||| |||||| |||||    
45355367 tattctcagtgggaaatgaaaggtgttcctctaaggattgaaatcgggcccaaggatttagcaaataagcaggt 45355440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125181 times since January 2019
Visitors: 1454