View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_21 (Length: 212)

Name: NF1856_high_21
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_21
[»] chr3 (4 HSPs)
chr3 (12-202)||(53498819-53499009)
chr3 (12-202)||(53491223-53491415)
chr3 (20-108)||(16069999-16070087)
chr3 (25-63)||(53516478-53516516)
[»] chr7 (1 HSPs)
chr7 (23-96)||(45355367-45355440)

Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr3

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 53499009 - 53498819
12 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 111  Q
53499009 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 53498910  T
112 gttgttgctcttatattctcacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 202  Q
53498909 gttgttgctcttatattctcacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 53498819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 12 - 202
Target Start/End: Complemental strand, 53491415 - 53491223
12 ctgaaaagaagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgtcct 111  Q
    |||||| |||||||||||| |||||| ||||||| ||||||||||||||||||||| |||||| |||||||| |||||| |||||||||||||||||| |    
53491415 ctgaaaggaagtattctgattgggaattgaaaggtgtccctctaaggattgaaattgggccaaaggatttagtaaataagcaggttatctatgttgtctt 53491316  T
112 gttgttgctcttatattct--cacatgtcattttgcttctaccctgtatgttcaatgagacaccaaataaatcacttcaattttgcacaggtt 202  Q
    |||||||||||||||||||  || ||||||||||||||||||  | |||||||||||||| ||||||||||||||||||||||| ||||||||    
53491315 gttgttgctcttatattcttacatatgtcattttgcttctactgtttatgttcaatgagataccaaataaatcacttcaatttttcacaggtt 53491223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 16070087 - 16069999
20 aagtattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggttatctatgttgt 108  Q
    |||||||||||||||||||||||||| |||||| ||| | |||||||| ||| || || ||||| |||||| ||||||||  |||||||    
16070087 aagtattctgaatgggaaatgaaaggtgtccctttaatggttgaaattgggctaaagggtttaggaaataagcaggttattaatgttgt 16069999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 25 - 63
Target Start/End: Complemental strand, 53516516 - 53516478
25 ttctgaatgggaaatgaaaggcgtccctctaaggattga 63  Q
    ||||||||||||||||||||| |||||||||||||||||    
53516516 ttctgaatgggaaatgaaaggtgtccctctaaggattga 53516478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 45355367 - 45355440
23 tattctgaatgggaaatgaaaggcgtccctctaaggattgaaattaggccaatggatttagaaaataaacaggt 96  Q
    |||||| | |||||||||||||| || |||||||||||||||||  |||| | |||||||| |||||| |||||    
45355367 tattctcagtgggaaatgaaaggtgttcctctaaggattgaaatcgggcccaaggatttagcaaataagcaggt 45355440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 14429 times since January 2019
Visitors: 570