View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_3 (Length: 485)

Name: NF1856_high_3
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_3
NF1856_high_3
[»] chr8 (1 HSPs)
chr8 (1-467)||(18320100-18320566)
[»] chr2 (1 HSPs)
chr2 (281-335)||(17556383-17556437)


Alignment Details
Target: chr8 (Bit Score: 439; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 1 - 467
Target Start/End: Complemental strand, 18320566 - 18320100
Alignment:
1 gtgatcaagagataaacttgtgttggataaatcatctgcagaactattccattctctatacacatatgttacaataaaattcattcccctagtgataagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18320566 gtgatcaagagataaacttgtgttggataaatcatctgcagaactattccattctctatacacatatgttacaataaaattcattcccctagtgataagc 18320467  T
101 aggcagttgttccatctgttccttaaaggccaaggaatcagagatgaattcttaaagcatttaccaataaaactgaattagattctaaccaaagattgct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
18320466 aggcagttgttccatctgttccttaaaggccaaggaatcagagatgaattcttaaagcatttaccaataaaactgaatcagattctaaccaaagattgct 18320367  T
201 tcattgatgttgcttagctaactatatggctctcattgctccagatagctctgcatagaaagaatttctagcacttgtattttctgcaaagaaaagaagg 300  Q
    |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18320366 tcattgatgttgcttagctagctctatggctctcattgctctagatagctctgcatagaaagaatttctagcacttgtattttctgcaaagaaaagaagg 18320267  T
301 agatttaagtctttatctttgaaaattcctccacaagataatgtattggtatttgctgagcaatatgtgttacatttgacccaataaaagagaggaggtt 400  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
18320266 agatttgagtctttatctctgaaaattcctccacaagataatgtattggtatttgctgagcaatatgtgttacatttgacccaatgaaagagaggaggtt 18320167  T
401 gtcatattacttcaataatcttgggtaatttaggagggtgaatgcaaatattatatttctttaaaaa 467  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18320166 gtcatattacttcaataatcttgggtaatttaggagggtgaatgcaaatattatatttctttaaaaa 18320100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 335
Target Start/End: Original strand, 17556383 - 17556437
Alignment:
281 tttctgcaaagaaaagaaggagatttaagtctttatctttgaaaattcctccaca 335  Q
    ||||||||||| ||||||| || ||  ||||||||||||||||||| ||||||||    
17556383 tttctgcaaagcaaagaagaagcttagagtctttatctttgaaaatacctccaca 17556437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38217 times since January 2019
Visitors: 1598