View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_6 (Length: 421)

Name: NF1856_high_6
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_6
[»] chr6 (1 HSPs)
chr6 (1-386)||(23126031-23126418)

Alignment Details
Target: chr6 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 23126418 - 23126031
1 aagaagaatatgattttaaccagacttacttatgaaatatctctgaaaattggttttgtttatagtagtagtagatggggggcagaagtatctacagcac 100  Q
23126418 aagaagaatatgattttaaccagacttacttatgaaatatctctgaaaattggttttgtttatagtagtagtagatggggggcagaagtatctacagcac 23126319  T
101 cctaggtggattagatcagaaagaaaaatgtacataaaactgaaggacacaaaacctgacctctagtgtnnnnnnncaaacatcccagaagggtaataca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||    
23126318 cctaggtggattagatcagaaagaaaaatgtacataaaactgaaggacacaaaacctgacctctagtgtaaaaaaacaaacatcccagaagggtaataca 23126219  T
201 aaacaaccattgaggtaacgaaaacacatatcctaatctaagagctagcggcgcaccacgtgcaaaatccaacgagtctgcgtacagacac--aactgaa 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
23126218 aaacaaccattgaggtaacgaaaacacatatcctaatctaagagctagcggcgcaccacgtgcaaaatccaacgagtctgcgtacagacacaaaactgaa 23126119  T
299 atgtnnnnnnnnngaggtgtgtgagctgacaagcctctttaagaatgggaatgaagttgcacccttagttttagtgaacggtaaagaa 386  Q
    ||||         ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
23126118 atgtaaaaaaaaagaggtgtgtgagctgacaagcctctttaacaatgggaatgaagttgcacccatagttttagtgaacggtaaagaa 23126031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 115869 times since January 2019
Visitors: 1394