View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_11 (Length: 319)

Name: NF1856_low_11
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_low_11
[»] chr5 (1 HSPs)
chr5 (6-295)||(7562019-7562308)
[»] chr8 (1 HSPs)
chr8 (245-281)||(33148838-33148874)

Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 295
Target Start/End: Complemental strand, 7562308 - 7562019
6 gtcgaagaatatggccaatgattgagaaatttagtaatttcttagatgttggtaattaagtgtttgttttgatgttgtaaaggaaattgaaagcaagaga 105  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7562308 gtcgaagaagatggccaatgattgagaaatttagtaatttcttagatgttggtaattaagtgtttgttttgatgttgtaaaggaaattgaaagcaagaga 7562209  T
106 aatgnnnnnnnnnnnnnnnnnnngattgatgatgaatggagaaaagatacctgagatgacggataacaggggttctcaacaaaaagaaaaggaaaacatg 205  Q
    ||||                   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7562208 aatgtttttttaatttattttttgattgatgatgaatggagaaaagatacctgagatgacggataacaggggttctcaacaaaaagaaaaggaaaacatg 7562109  T
206 gttagactaaaaagtacgtaataccaaaggaaccaattattgtctttcctcaatgatctcctacaaaggaggacctctatctttctcaat 295  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||    
7562108 gttagactaaaaagtacgtaataccaaaggaaccaattgttgtctttcctcaatgatctcctacaaaagaggacctttatctttctcaat 7562019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 281
Target Start/End: Original strand, 33148838 - 33148874
245 ttgtctttcctcaatgatctcctacaaaggaggacct 281  Q
    |||||||||||||||| ||||||||||||||||||||    
33148838 ttgtctttcctcaatggtctcctacaaaggaggacct 33148874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 198751 times since January 2019
Visitors: 2774