View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_13 (Length: 309)

Name: NF1856_low_13
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_low_13
[»] chr6 (1 HSPs)
chr6 (14-293)||(29008878-29009157)

Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 293
Target Start/End: Original strand, 29008878 - 29009157
14 gaagccaagacgaccacgaacatagctttcactgcccagactggcctcattttcctannnnnnnnnnnnnnnnnnnnnnnncacagagttaactatagct 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                        |||||||||||||||||||    
29008878 gaagccaagacgaccacgaacatagctttcactgcccagactggcctcattttcctacaaatcaaaccaaaaaatcaaaaacacagagttaactatagct 29008977  T
114 tcgattcaaattcttcatctaattgaatgaatataacaccgtaacagtgtcaaatgaaattgaagaattagtttcagtgaaaatagtagcgtgcaaatgc 213  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||    
29008978 tcgattcaaattcttcatctaatcgaatgaatacaacaccgtaacagtatcaaatgcaattgaagaattagtttcagtgaaaattgtagcgtgcaaatgc 29009077  T
214 aaattatatagaaatgtgaaggtgaatttgaataaaatgaaaccagaatcggaatttgaagaatttaatcaagaagttga 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
29009078 aaattatatagaaatgtgaaggtgaatttgaataaaatgaaaccagaatcggaatttgaagaatgtaatcaagaagttga 29009157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176109 times since January 2019
Visitors: 2680