View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_13 (Length: 309)

Name: NF1856_low_13
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_low_13
NF1856_low_13
[»] chr6 (1 HSPs)
chr6 (14-293)||(29008878-29009157)


Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 293
Target Start/End: Original strand, 29008878 - 29009157
Alignment:
14 gaagccaagacgaccacgaacatagctttcactgcccagactggcctcattttcctannnnnnnnnnnnnnnnnnnnnnnncacagagttaactatagct 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                        |||||||||||||||||||    
29008878 gaagccaagacgaccacgaacatagctttcactgcccagactggcctcattttcctacaaatcaaaccaaaaaatcaaaaacacagagttaactatagct 29008977  T
114 tcgattcaaattcttcatctaattgaatgaatataacaccgtaacagtgtcaaatgaaattgaagaattagtttcagtgaaaatagtagcgtgcaaatgc 213  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||    
29008978 tcgattcaaattcttcatctaatcgaatgaatacaacaccgtaacagtatcaaatgcaattgaagaattagtttcagtgaaaattgtagcgtgcaaatgc 29009077  T
214 aaattatatagaaatgtgaaggtgaatttgaataaaatgaaaccagaatcggaatttgaagaatttaatcaagaagttga 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
29009078 aaattatatagaaatgtgaaggtgaatttgaataaaatgaaaccagaatcggaatttgaagaatgtaatcaagaagttga 29009157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38138 times since January 2019
Visitors: 1598