View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_3 (Length: 485)

Name: NF1856_low_3
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_low_3
[»] chr8 (1 HSPs)
chr8 (1-467)||(18320100-18320566)
[»] chr2 (1 HSPs)
chr2 (281-335)||(17556383-17556437)

Alignment Details
Target: chr8 (Bit Score: 439; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 1 - 467
Target Start/End: Complemental strand, 18320566 - 18320100
1 gtgatcaagagataaacttgtgttggataaatcatctgcagaactattccattctctatacacatatgttacaataaaattcattcccctagtgataagc 100  Q
18320566 gtgatcaagagataaacttgtgttggataaatcatctgcagaactattccattctctatacacatatgttacaataaaattcattcccctagtgataagc 18320467  T
101 aggcagttgttccatctgttccttaaaggccaaggaatcagagatgaattcttaaagcatttaccaataaaactgaattagattctaaccaaagattgct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
18320466 aggcagttgttccatctgttccttaaaggccaaggaatcagagatgaattcttaaagcatttaccaataaaactgaatcagattctaaccaaagattgct 18320367  T
201 tcattgatgttgcttagctaactatatggctctcattgctccagatagctctgcatagaaagaatttctagcacttgtattttctgcaaagaaaagaagg 300  Q
    |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18320366 tcattgatgttgcttagctagctctatggctctcattgctctagatagctctgcatagaaagaatttctagcacttgtattttctgcaaagaaaagaagg 18320267  T
301 agatttaagtctttatctttgaaaattcctccacaagataatgtattggtatttgctgagcaatatgtgttacatttgacccaataaaagagaggaggtt 400  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
18320266 agatttgagtctttatctctgaaaattcctccacaagataatgtattggtatttgctgagcaatatgtgttacatttgacccaatgaaagagaggaggtt 18320167  T
401 gtcatattacttcaataatcttgggtaatttaggagggtgaatgcaaatattatatttctttaaaaa 467  Q
18320166 gtcatattacttcaataatcttgggtaatttaggagggtgaatgcaaatattatatttctttaaaaa 18320100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 335
Target Start/End: Original strand, 17556383 - 17556437
281 tttctgcaaagaaaagaaggagatttaagtctttatctttgaaaattcctccaca 335  Q
    ||||||||||| ||||||| || ||  ||||||||||||||||||| ||||||||    
17556383 tttctgcaaagcaaagaagaagcttagagtctttatctttgaaaatacctccaca 17556437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295150 times since January 2019
Visitors: 3016