View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_4 (Length: 466)

Name: NF1856_low_4
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_low_4
NF1856_low_4
[»] scaffold0148 (1 HSPs)
scaffold0148 (10-442)||(27756-28188)


Alignment Details
Target: scaffold0148 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: scaffold0148
Description:

Target: scaffold0148; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 10 - 442
Target Start/End: Complemental strand, 28188 - 27756
Alignment:
10 gacatcatctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28188 gacatcagctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag 28089  T
110 taattcgtaacgaacagtataacaataaaagattgttcctcaattcgacaggtgtgatacagtgggtggaagatgatttgccagttatatggaagcagcc 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||    
28088 taattcgtaacgaacagtataacaataaaagattgttcctcaattccacaggtgtgatacagtgggtggaagatgatttgctagttatatggaagcagcc 27989  T
210 aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27988 aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac 27889  T
310 cagggagaggaagattcttcacgacattgtacgaggagaaaaacaacattctgttctgaaaatgacatgaagttcttgaacttgaccatgattaaaacag 409  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
27888 cagggagaggaagattcttcacgacattgtacgaggagaaaaacaacattctgtactgaaaatgacacgaagttcttgaacttgaccatgattaaaacag 27789  T
410 gaaagccagataaaaaggcaaccgtggaatctc 442  Q
    ||| |||||||| ||||| ||||||||||||||    
27788 gaaggccagatataaaggtaaccgtggaatctc 27756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175376 times since January 2019
Visitors: 2677