View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_4 (Length: 466)

Name: NF1856_low_4
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_low_4
[»] scaffold0148 (1 HSPs)
scaffold0148 (10-442)||(27756-28188)

Alignment Details
Target: scaffold0148 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: scaffold0148

Target: scaffold0148; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 10 - 442
Target Start/End: Complemental strand, 28188 - 27756
10 gacatcatctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28188 gacatcagctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag 28089  T
110 taattcgtaacgaacagtataacaataaaagattgttcctcaattcgacaggtgtgatacagtgggtggaagatgatttgccagttatatggaagcagcc 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||    
28088 taattcgtaacgaacagtataacaataaaagattgttcctcaattccacaggtgtgatacagtgggtggaagatgatttgctagttatatggaagcagcc 27989  T
210 aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac 309  Q
27988 aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac 27889  T
310 cagggagaggaagattcttcacgacattgtacgaggagaaaaacaacattctgttctgaaaatgacatgaagttcttgaacttgaccatgattaaaacag 409  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
27888 cagggagaggaagattcttcacgacattgtacgaggagaaaaacaacattctgtactgaaaatgacacgaagttcttgaacttgaccatgattaaaacag 27789  T
410 gaaagccagataaaaaggcaaccgtggaatctc 442  Q
    ||| |||||||| ||||| ||||||||||||||    
27788 gaaggccagatataaaggtaaccgtggaatctc 27756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 30114 times since January 2019
Visitors: 1588