View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_low_6 (Length: 421)

Name: NF1856_low_6
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_low_6
NF1856_low_6
[»] chr6 (1 HSPs)
chr6 (1-386)||(23126031-23126418)


Alignment Details
Target: chr6 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 23126418 - 23126031
Alignment:
1 aagaagaatatgattttaaccagacttacttatgaaatatctctgaaaattggttttgtttatagtagtagtagatggggggcagaagtatctacagcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23126418 aagaagaatatgattttaaccagacttacttatgaaatatctctgaaaattggttttgtttatagtagtagtagatggggggcagaagtatctacagcac 23126319  T
101 cctaggtggattagatcagaaagaaaaatgtacataaaactgaaggacacaaaacctgacctctagtgtnnnnnnncaaacatcccagaagggtaataca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||    
23126318 cctaggtggattagatcagaaagaaaaatgtacataaaactgaaggacacaaaacctgacctctagtgtaaaaaaacaaacatcccagaagggtaataca 23126219  T
201 aaacaaccattgaggtaacgaaaacacatatcctaatctaagagctagcggcgcaccacgtgcaaaatccaacgagtctgcgtacagacac--aactgaa 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
23126218 aaacaaccattgaggtaacgaaaacacatatcctaatctaagagctagcggcgcaccacgtgcaaaatccaacgagtctgcgtacagacacaaaactgaa 23126119  T
299 atgtnnnnnnnnngaggtgtgtgagctgacaagcctctttaagaatgggaatgaagttgcacccttagttttagtgaacggtaaagaa 386  Q
    ||||         ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
23126118 atgtaaaaaaaaagaggtgtgtgagctgacaagcctctttaacaatgggaatgaagttgcacccatagttttagtgaacggtaaagaa 23126031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199023 times since January 2019
Visitors: 2774