View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-10 (Length: 80)

Name: NF1883-3-Insertion-10
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-10
[»] chr4 (8 HSPs)
chr4 (1-80)||(7004232-7004311)
chr4 (1-80)||(7027056-7027135)
chr4 (1-80)||(7046844-7046923)
chr4 (6-80)||(7013753-7013827)
chr4 (31-80)||(7052876-7052925)
chr4 (31-79)||(7020192-7020240)
chr4 (27-80)||(6994318-6994371)
chr4 (35-80)||(7039510-7039555)

Alignment Details
Target: chr4 (Bit Score: 80; Significance: 3e-38; HSPs: 8)
Name: chr4

Target: chr4; HSP #1
Raw Score: 80; E-Value: 3e-38
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7004311 - 7004232
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
7004311 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 7004232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7027135 - 7027056
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
7027135 ggtagtagaagcaacaaatagagattatggttggaaacctggagatttatcaatggctggagacctttttcatttcctgt 7027056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7046923 - 7046844
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||    
7046923 ggtagtagaagcaacaaatagagattatgattggaaacctggagatttatcaatggttggtgaccttcttcatttcctgt 7046844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 7013827 - 7013753
6 tagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    ||||||||||  | ||| ||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||||    
7013827 tagaagcaactgacagagattatggttcggaaccttgagatttatcaatggttggagacctttttcatttcctgt 7013753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 80
Target Start/End: Complemental strand, 7052925 - 7052876
31 ttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||||||||||| | |||||||||||||||||    
7052925 ttggaaacctggagatttatcaatggttggagtcctttttcatttcctgt 7052876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 7020240 - 7020192
31 ttggaaacctggagatttatcaatggttggtgacctttttcatttcctg 79  Q
    |||||||||||||||||||||||||||||| | ||||||||||||||||    
7020240 ttggaaacctggagatttatcaatggttggagtcctttttcatttcctg 7020192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 6994371 - 6994318
27 atggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||| | ||||| ||||||||||||||||||| |||||||||||||||||||    
6994371 atggtttggaaccttgagatttatcaatggttggagacctttttcatttcctgt 6994318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 7039555 - 7039510
35 aaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    ||||||||||||||||||||||| || | |||||||||||||||||    
7039555 aaacctggagatttatcaatggtaggagtcctttttcatttcctgt 7039510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC