View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-12 (Length: 74)

Name: NF1883-3-Insertion-12
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-12
[»] chr1 (1 HSPs)
chr1 (1-74)||(10029004-10029077)

Alignment Details
Target: chr1 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 10029077 - 10029004
1 caaacatcagcaaaagccacatctgatgaaaaacacacggcagaaaccgaaaacctgaatggaagcaacaacaa 74  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
10029077 caaacatcagcaaaagccacatctgatgaaaaacacaaggcagaaaccgaaaacctgaatggaagcaacaacaa 10029004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84220 times since January 2019
Visitors: 2323