View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-16 (Length: 38)

Name: NF1883-3-Insertion-16
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-16
NF1883-3-Insertion-16
[»] chr4 (1 HSPs)
chr4 (1-38)||(37887800-37887837)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 37887800 - 37887837
Alignment:
1 tagagctacatctcccttgcctcctgttaaagccagga 38  Q
    ||||||||||||||| ||||||||||||||||||||||    
37887800 tagagctacatctcctttgcctcctgttaaagccagga 37887837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC