View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-17 (Length: 41)

Name: NF1883-3-Insertion-17
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-17
NF1883-3-Insertion-17
[»] chr4 (5 HSPs)
chr4 (1-41)||(5161028-5161068)
chr4 (1-41)||(4856042-4856082)
chr4 (2-41)||(5214833-5214872)
chr4 (2-41)||(7143175-7143214)
chr4 (5-32)||(5183273-5183300)


Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.000000000000002; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 5161028 - 5161068
Alignment:
1 cttggaaggagatattccaattcaattgtgtcgattaaaaa 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
5161028 cttggaaggagatattccaattcaattgtgtcgattaaaaa 5161068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 4856082 - 4856042
Alignment:
1 cttggaaggagatattccaattcaattgtgtcgattaaaaa 41  Q
    ||||||||||||||||||||||||||||||||| |||||||    
4856082 cttggaaggagatattccaattcaattgtgtcggttaaaaa 4856042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 41
Target Start/End: Original strand, 5214833 - 5214872
Alignment:
2 ttggaaggagatattccaattcaattgtgtcgattaaaaa 41  Q
    |||||||||||||||||||||||||||||||| |||||||    
5214833 ttggaaggagatattccaattcaattgtgtcggttaaaaa 5214872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 41
Target Start/End: Original strand, 7143175 - 7143214
Alignment:
2 ttggaaggagatattccaattcaattgtgtcgattaaaaa 41  Q
    |||||||||||||||||||||||||||||||| |||||||    
7143175 ttggaaggagatattccaattcaattgtgtcggttaaaaa 7143214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 32
Target Start/End: Original strand, 5183273 - 5183300
Alignment:
5 gaaggagatattccaattcaattgtgtc 32  Q
    ||||||||||||||||||||||||||||    
5183273 gaaggagatattccaattcaattgtgtc 5183300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC