View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-19 (Length: 47)

Name: NF1883-3-Insertion-19
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-19
NF1883-3-Insertion-19
[»] chr2 (1 HSPs)
chr2 (1-47)||(5432365-5432413)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 5432413 - 5432365
Alignment:
1 gattcaacttttgaaagaga--ggttctttcatagtcaagatagcgttt 47  Q
    ||||||||||||||||||||  |||||| ||||||||||||||||||||    
5432413 gattcaacttttgaaagagaaaggttctatcatagtcaagatagcgttt 5432365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105329 times since January 2019
Visitors: 2324