View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-2 (Length: 276)

Name: NF1883-3-Insertion-2
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-2
NF1883-3-Insertion-2
[»] chr5 (1 HSPs)
chr5 (3-276)||(26357641-26357924)
[»] chr6 (4 HSPs)
chr6 (25-259)||(6684891-6685125)
chr6 (25-228)||(30821866-30822069)
chr6 (25-217)||(30812604-30812796)
chr6 (26-183)||(12592570-12592727)
[»] chr1 (1 HSPs)
chr1 (25-253)||(51759491-51759719)
[»] chr8 (1 HSPs)
chr8 (25-249)||(27810616-27810826)


Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 3 - 276
Target Start/End: Original strand, 26357641 - 26357924
Alignment:
3 atacataaccaagagtaagaactaagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgtta 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
26357641 atacataaccaagagtaagaactaagaactgatgcaatacctaaagattcaacaagctattactaacactccaaatcaaaagggtagcatccaattgtta 26357740  T
103 tactaacataccaaatcaaaagttggttgtac----------aacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttggatggactg 192  Q
    ||||||||||||||||||||||||||||||||          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
26357741 tactaacataccaaatcaaaagttggttgtacaacactgataaacactgatatcaaacatgtaagctagtaatatccaaatcactgtgttggatggactg 26357840  T
193 agaagacaatttcaaatatatgccagaaacaactcccaggttaatccatccttcacaatgttatcataaagattctagagataa 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26357841 agaagacaatttcaaatatatgccagaaacaactcccaggttaatccatccttcacaatgttatcataaagattctagagataa 26357924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 25 - 259
Target Start/End: Original strand, 6684891 - 6685125
Alignment:
25 taagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaag 124  Q
    |||||||||||||| |||||||||||||||||||||||  | ||||||| |||||||||||| ||||||||| ||||||||||| || ||||||||||||    
6684891 taagaactgatgcagtacctaaagattcaacaagctatacctaacactctaaatcaaaagggcagcatccaactgttatactaatattccaaatcaaaag 6684990  T
125 ttggttgtacaacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttggatggactgagaagacaatttcaaatatatgccagaaacaa 224  Q
    |||||||||||| |||||||||| ||||||| ||||||||||||||||| ||| ||||| ||||||||||||||||||||  ||||||||||| ||||||    
6684991 ttggttgtacaaaactgatatcatacatgtaagctagtaatatccaaataactatgttgaatggactgagaagacaattttgaatatatgccaaaaacaa 6685090  T
225 ctcccaggttaatccatccttcacaatgttatcat 259  Q
    |||||| |||||||||| ||||||||||| |||||    
6685091 ctcccaagttaatccatacttcacaatgtcatcat 6685125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 25 - 228
Target Start/End: Original strand, 30821866 - 30822069
Alignment:
25 taagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaag 124  Q
    ||||||||||| || |||||||| ||||||||||||||||| |||||||  ||||||||||| ||||||||| |||||||||||||| ||||||||||||    
30821866 taagaactgattcagtacctaaatattcaacaagctattactaacactcttaatcaaaagggcagcatccaactgttatactaacattccaaatcaaaag 30821965  T
125 ttggttgtacaacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttggatggactgagaagacaatttcaaatatatgccagaaacaa 224  Q
    |||||||||||| |||||||||| ||||||| ||||||||||||||||| ||| ||||| ||||| ||||||||||||||  ||||||||||||||| ||    
30821966 ttggttgtacaaaactgatatcatacatgtaagctagtaatatccaaataactatgttgaatggattgagaagacaattttgaatatatgccagaaaaaa 30822065  T
225 ctcc 228  Q
    ||||    
30822066 ctcc 30822069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 25 - 217
Target Start/End: Original strand, 30812604 - 30812796
Alignment:
25 taagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaag 124  Q
    ||||||||||| || |||||||||||||||||||||||||| |||||||  |||||| |||| | ||||||| ||||||||||||||  ||||||||||     
30812604 taagaactgattcagtacctaaagattcaacaagctattactaacactcttaatcaacagggcaacatccaactgttatactaacatttcaaatcaaaaa 30812703  T
125 ttggttgtacaacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttggatggactgagaagacaatttcaaatatatgcca 217  Q
    |||||||||||| ||| |||||| ||||||| ||||||||||||||||| ||| ||||| ||||||||||||||||||||  |||| ||||||    
30812704 ttggttgtacaaaactaatatcatacatgtaagctagtaatatccaaataactatgttgaatggactgagaagacaattttgaataaatgcca 30812796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 26 - 183
Target Start/End: Original strand, 12592570 - 12592727
Alignment:
26 aagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaagt 125  Q
    ||||| ||||| | ||||||||||||||| |||||||||| ||||  | |||||||||||| ||||||||| |||||||||||||| |||||||||||||    
12592570 aagaattgatgtagtacctaaagattcaataagctattactaacaaactaaatcaaaagggcagcatccaactgttatactaacattccaaatcaaaagt 12592669  T
126 tggttgtacaacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttg 183  Q
    ||||||||||| ||||||| || ||||||| ||||||||||||||||| ||| |||||    
12592670 tggttgtacaaaactgataacatacatgtaagctagtaatatccaaataactatgttg 12592727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 25 - 253
Target Start/End: Original strand, 51759491 - 51759719
Alignment:
25 taagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaag 124  Q
    |||||||||||||| || ||||||||||||||||||||||| ||||||| |||||||||||| ||||||||| |||||||||||||| ||||||||||||    
51759491 taagaactgatgcagtatctaaagattcaacaagctattactaacactctaaatcaaaagggcagcatccaactgttatactaacattccaaatcaaaag 51759590  T
125 ttggttgtacaacactgatatcaaacatgtatgctagtaatatccaaatcactgtgttggatggactgagaagacaatttcaaatatatgccagaaacaa 224  Q
    |||||||||||| |||||||||| ||||||| |||||||||||| |||| ||| ||||| ||||| ||||||||||||||  ||||||| ||||||||||    
51759591 ttggttgtacaaaactgatatcatacatgtaagctagtaatatctaaataactatgttgaatggattgagaagacaattttgaatatataccagaaacaa 51759690  T
225 ctcccaggttaatccatccttcacaatgt 253  Q
    |||| | |||||||||| |||||||||||    
51759691 ctccgaagttaatccatacttcacaatgt 51759719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 25 - 249
Target Start/End: Original strand, 27810616 - 27810826
Alignment:
25 taagaactgatgcaatacctaaagattcaacaagctattaccaacactccaaatcaaaagggtagcatccaattgttatactaacataccaaatcaaaag 124  Q
    |||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||| ||                |||||| ||||||||||||    
27810616 taagaactgatgcagtacctaaagattcaacaagctattactaacactctaaatcaaaagggcag----------------taacattccaaatcaaaag 27810699  T
125 ttggttgtacaacactgatatcaaacatgtatgcta--gtaatatccaaatcactgtgttggatggactgagaagacaatttcaaatatatgccagaaac 222  Q
    |||||||||||| |||||||||| ||||||| ||||  ||||||||||||| ||| ||||| |||||||||||| |||||||  |||||| ||||||||     
27810700 ttggttgtacaaaactgatatcatacatgtaagctatagtaatatccaaataactatgttgaatggactgagaatacaattttgaatataagccagaaaa 27810799  T
223 aactcccaggttaatccatccttcaca 249  Q
    |||||||| |||||||||| |||||||    
27810800 aactcccaagttaatccatacttcaca 27810826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC