View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-20 (Length: 39)

Name: NF1883-3-Insertion-20
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-20
[»] chr6 (3 HSPs)
chr6 (1-39)||(2623330-2623368)
chr6 (1-39)||(2591786-2591824)
chr6 (1-36)||(33786356-33786391)

Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.00000000000003; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2623330 - 2623368
1 taccggaaaagttatcgctgatgctggtagcatgacgaa 39  Q
2623330 taccggaaaagttatcgctgatgctggtagcatgacgaa 2623368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2591786 - 2591824
1 taccggaaaagttatcgctgatgctggtagcatgacgaa 39  Q
    |||||||||||| || |||||||||||||||||||||||    
2591786 taccggaaaagtaattgctgatgctggtagcatgacgaa 2591824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 33786391 - 33786356
1 taccggaaaagttatcgctgatgctggtagcatgac 36  Q
    ||||||||||||||| ||||| ||||||||||||||    
33786391 taccggaaaagttatagctgaagctggtagcatgac 33786356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC