View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-20 (Length: 39)

Name: NF1883-3-Insertion-20
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-20
NF1883-3-Insertion-20
[»] chr6 (3 HSPs)
chr6 (1-39)||(2623330-2623368)
chr6 (1-39)||(2591786-2591824)
chr6 (1-36)||(33786356-33786391)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.00000000000003; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2623330 - 2623368
Alignment:
1 taccggaaaagttatcgctgatgctggtagcatgacgaa 39  Q
    |||||||||||||||||||||||||||||||||||||||    
2623330 taccggaaaagttatcgctgatgctggtagcatgacgaa 2623368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2591786 - 2591824
Alignment:
1 taccggaaaagttatcgctgatgctggtagcatgacgaa 39  Q
    |||||||||||| || |||||||||||||||||||||||    
2591786 taccggaaaagtaattgctgatgctggtagcatgacgaa 2591824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 33786391 - 33786356
Alignment:
1 taccggaaaagttatcgctgatgctggtagcatgac 36  Q
    ||||||||||||||| ||||| ||||||||||||||    
33786391 taccggaaaagttatagctgaagctggtagcatgac 33786356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95131 times since January 2019
Visitors: 2229