View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-21 (Length: 37)

Name: NF1883-3-Insertion-21
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-21
[»] chr7 (2 HSPs)
chr7 (1-37)||(21773151-21773187)
chr7 (1-37)||(21786679-21786715)

Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.0000000000005; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 21773151 - 21773187
1 aaaaggtcaagatgatgacataccggaacatacaaga 37  Q
21773151 aaaaggtcaagatgatgacataccggaacatacaaga 21773187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 21786679 - 21786715
1 aaaaggtcaagatgatgacataccggaacatacaaga 37  Q
21786679 aaaaggtcaagatgatgacataccggaacatacaaga 21786715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC