View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-23 (Length: 26)

Name: NF1883-3-Insertion-23
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-23
NF1883-3-Insertion-23
[»] chr8 (2 HSPs)
chr8 (1-26)||(15315435-15315460)
chr8 (1-26)||(15495804-15495829)
[»] chr7 (1 HSPs)
chr7 (1-26)||(41718028-41718053)


Alignment Details
Target: chr8 (Bit Score: 26; Significance: 0.0000009; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 26; E-Value: 0.0000009
Query Start/End: Original strand, 1 - 26
Target Start/End: Complemental strand, 15315460 - 15315435
Alignment:
1 ctttaagtatcatgtttgtttcagat 26  Q
    ||||||||||||||||||||||||||    
15315460 ctttaagtatcatgtttgtttcagat 15315435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 26; E-Value: 0.0000009
Query Start/End: Original strand, 1 - 26
Target Start/End: Complemental strand, 15495829 - 15495804
Alignment:
1 ctttaagtatcatgtttgtttcagat 26  Q
    ||||||||||||||||||||||||||    
15495829 ctttaagtatcatgtttgtttcagat 15495804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 26; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 26; E-Value: 0.0000009
Query Start/End: Original strand, 1 - 26
Target Start/End: Original strand, 41718028 - 41718053
Alignment:
1 ctttaagtatcatgtttgtttcagat 26  Q
    ||||||||||||||||||||||||||    
41718028 ctttaagtatcatgtttgtttcagat 41718053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 94987 times since January 2019
Visitors: 2223