View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-4 (Length: 228)

Name: NF1883-3-Insertion-4
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-4
NF1883-3-Insertion-4
[»] chr3 (1 HSPs)
chr3 (1-228)||(46011352-46011582)
[»] chr2 (1 HSPs)
chr2 (53-225)||(15924455-15924629)
[»] chr1 (1 HSPs)
chr1 (53-225)||(13116273-13116447)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 46011352 - 46011582
Alignment:
1 tttatcacctggggaatctgaaatatcagaattagtgaagctaattgctgagaaaaaa-tgaatgagaatcatgtattggaaaaa-tgatggaggaaggt 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||| ||||||||||||||    
46011352 tttatcacctggggaatctgaaatatcagaattagtgaagctaattgctgagaaaaaaatgaacgagaatcatggattggaaaaaatgatggaggaaggt 46011451  T
99 gaaggaaa-gatgattttattgtttatggagcaaagttaacatttgtagatttggaagaaggtaatttttatggtgtaaagattaatgggcagaaaccaa 197  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46011452 gaaggaaaagatgattttattgtttatggagcaaagttaacatttgtagatttggaagaaggtaatttttatggtgtaaagattaatgggcagaaaccaa 46011551  T
198 ttttggcaaattgtgattttcgtggtgtggg 228  Q
    |||||||||||||||||||||||||||||||    
46011552 ttttggcaaattgtgattttcgtggtgtggg 46011582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 53 - 225
Target Start/End: Original strand, 15924455 - 15924629
Alignment:
53 aaaaaatgaatgagaatcatgtattggaaaaat-gatggaggaaggtgaaggaaa-gatgattttattgtttatggagcaaagttaacatttgtagattt 150  Q
    ||||||| ||||||||| ||| ||||||||||| | ||||| ||||||| ||||| ||||||||| |||| |||||||||||||||||||||||||| ||    
15924455 aaaaaattaatgagaattatgcattggaaaaattggtggagaaaggtgatggaaaagatgatttttttgtatatggagcaaagttaacatttgtagactt 15924554  T
151 ggaagaaggtaatttttatggtgtaaagattaatgggcagaaaccaattttggcaaattgtgattttcgtggtgt 225  Q
    |||||||| | |||| |||||||||||| |||||||  ||||||| |||  ||| ||||||||||| ||||||||    
15924555 ggaagaagctgatttatatggtgtaaagcttaatggaaagaaacctattagggcgaattgtgatttacgtggtgt 15924629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 53 - 225
Target Start/End: Original strand, 13116273 - 13116447
Alignment:
53 aaaaaatgaatgagaatcatgtattggaaaaa-tgatggaggaaggtgaagg-aaagatgattttattgtttatggagcaaagttaacatttgtagattt 150  Q
    |||||||||||||||||||||||||||||||| |  ||||||| |||||||| |||||  ||||||| ||||||||||| ||||||||||||||||| ||    
13116273 aaaaaatgaatgagaatcatgtattggaaaaaattgtggaggacggtgaaggcaaagagcattttatagtttatggagctaagttaacatttgtagactt 13116372  T
151 ggaagaaggtaatttttatggtgtaaagattaatgggcagaaaccaattttggcaaattgtgattttcgtggtgt 225  Q
    |||||| | | ||||||| |   ||||||||||||| |||||||| ||| ||| |||||||||||| || |||||    
13116373 ggaagaggctgatttttacgagataaagattaatggacagaaacccattatggtaaattgtgatttccgcggtgt 13116447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105641 times since January 2019
Visitors: 2328