View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-5 (Length: 190)

Name: NF1883-3-Insertion-5
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-5
[»] chr8 (3 HSPs)
chr8 (1-190)||(7804879-7805068)
chr8 (1-190)||(7834275-7834465)
chr8 (1-190)||(7784814-7785005)

Alignment Details
Target: chr8 (Bit Score: 174; Significance: 7e-94; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7805068 - 7804879
1 aatacgatataaattataacataaagcaaaaaactcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
7805068 aatacgatataaattataacataaagcaaaaaactcaatatgacaatgattaaagtcccactttctcatccaccaacatgaggttcatacatgttatctc 7804969  T
101 gttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
7804968 gttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacctgaatcttcagcttgaggtccttcttgccaacagacaccattg 7804879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7834465 - 7834275
1 aatacgatataaattataacataaagcaaaaaa-ctcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatct 99  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
7834465 aatacgatataaattataacataaagcaaaaaaactcaatatgacaatgattaaagacccactttctcatccaccaacaggaggttcatacatgttatct 7834366  T
100 cgttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7834365 cgttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacctgaatcttcagcttgaggtccttcttgccaccagacaccattg 7834275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7785005 - 7784814
1 aatacgatataaattataacataaagcaaaaaa--ctcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatc 98  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||    
7785005 aatacgatataaattataacataaagcaaaaaaaactcaatatgacaatgattaaagtcccactttctcatccaccaacatgaggttcatatatgttatc 7784906  T
99 tcgttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7784905 tcgttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaacagacaccattg 7784814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC