View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-5 (Length: 190)

Name: NF1883-3-Insertion-5
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-5
NF1883-3-Insertion-5
[»] chr8 (3 HSPs)
chr8 (1-190)||(7804879-7805068)
chr8 (1-190)||(7834275-7834465)
chr8 (1-190)||(7784814-7785005)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 7e-94; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7805068 - 7804879
Alignment:
1 aatacgatataaattataacataaagcaaaaaactcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
7805068 aatacgatataaattataacataaagcaaaaaactcaatatgacaatgattaaagtcccactttctcatccaccaacatgaggttcatacatgttatctc 7804969  T
101 gttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
7804968 gttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacctgaatcttcagcttgaggtccttcttgccaacagacaccattg 7804879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7834465 - 7834275
Alignment:
1 aatacgatataaattataacataaagcaaaaaa-ctcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatct 99  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
7834465 aatacgatataaattataacataaagcaaaaaaactcaatatgacaatgattaaagacccactttctcatccaccaacaggaggttcatacatgttatct 7834366  T
100 cgttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7834365 cgttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacctgaatcttcagcttgaggtccttcttgccaccagacaccattg 7834275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 7785005 - 7784814
Alignment:
1 aatacgatataaattataacataaagcaaaaaa--ctcaatatgacaatgattaaagacccactttctcatccaccaacatgaggttcatacatgttatc 98  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||    
7785005 aatacgatataaattataacataaagcaaaaaaaactcaatatgacaatgattaaagtcccactttctcatccaccaacatgaggttcatatatgttatc 7784906  T
99 tcgttagccttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaccagacaccattg 190  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7784905 tcgttaggcttttgtttgtcatgaatgcaccaaatatgtacttgaaacccgaatcttcagcttgaggtccttcttgccaacagacaccattg 7784814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93501 times since January 2019
Visitors: 2365