View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-6 (Length: 168)

Name: NF1883-3-Insertion-6
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-6
[»] chr7 (1 HSPs)
chr7 (2-168)||(36330729-36330901)

Alignment Details
Target: chr7 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 2 - 168
Target Start/End: Original strand, 36330729 - 36330901
2 ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaa------aaataga 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||    
36330729 ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaaaaatagaaataga 36330828  T
96 aatagaagggatgagttgcctgaaacatgaataattatattggcttatttgactttatcgtagtttatacata 168  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36330829 aatagaagggatgagttgcctgaaacatgaagaattatattggcttatttgactttatcgtagtttatacata 36330901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98523 times since January 2019
Visitors: 2275