View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-7 (Length: 166)

Name: NF1883-3-Insertion-7
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1883-3-Insertion-7
[»] chr3 (1 HSPs)
chr3 (1-166)||(41463419-41463584)

Alignment Details
Target: chr3 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 41463584 - 41463419
1 catacaacttggaataccttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttactgcgtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
41463584 catacaacttggaataccttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttactgtgtt 41463485  T
101 tgtgcacttgtcgtctgtctgtgatttggttgatactgttaacgtgccggttcaatcgccgttttt 166  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
41463484 tgtgcacttgtcgtctgtctgtgatttggttgataccgttaacgtgccggttcaatcgccgttttt 41463419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC