View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-1 (Length: 107)

Name: NF2496-1-Insertion-1
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF2496-1-Insertion-1
[»] chr3 (1 HSPs)
chr3 (11-107)||(34898039-34898135)

Alignment Details
Target: chr3 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 11 - 107
Target Start/End: Complemental strand, 34898135 - 34898039
11 caaactcaatattatacatcttacgtctatataagggacatgttactaccaatcaagatatgttcattcattcactcaatacctcccactcgagtca 107  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34898135 caaactcaatactatacatcttacgtctatataagggacatgttactaccaatcaagatatgttcattcattcactcaatacctcccactcgagtca 34898039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105332 times since January 2019
Visitors: 2324