View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-4 (Length: 176)

Name: NF2496-1-Insertion-4
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF2496-1-Insertion-4
[»] chr7 (1 HSPs)
chr7 (1-176)||(42929483-42929658)
[»] chr1 (2 HSPs)
chr1 (25-119)||(50463289-50463383)
chr1 (22-97)||(25531024-25531099)

Alignment Details
Target: chr7 (Bit Score: 176; Significance: 4e-95; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 176; E-Value: 4e-95
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 42929658 - 42929483
1 gaagcaaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctctt 100  Q
42929658 gaagcaaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctctt 42929559  T
101 gaagaccttcccaatctttaacatcgtgagcttctactatttcctccatagactttcgaaaatcgacataaggatc 176  Q
42929558 gaagaccttcccaatctttaacatcgtgagcttctactatttcctccatagactttcgaaaatcgacataaggatc 42929483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 4e-18; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 25 - 119
Target Start/End: Original strand, 50463289 - 50463383
25 aaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctcttgaagaccttcccaatcttt 119  Q
    |||||||||||||||||||||||| | ||||||||  ||||  |||| || |||||||||||||||||||||||||  | ||| |||||||||||    
50463289 aaatcaacaaaagcaccaacaataaacccatgattatttttaccattaactttcaaataccaactcaaaagctcttccaaaccatcccaatcttt 50463383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 22 - 97
Target Start/End: Original strand, 25531024 - 25531099
22 aataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagct 97  Q
    |||||||||| ||||||| ||| |||| | ||||||||  |||||||||| || |  |||||||||||||||||||    
25531024 aataaatcaaaaaaagcatcaataataaatccatgatttcttttctcattaacttcaaaataccaactcaaaagct 25531099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98242 times since January 2019
Visitors: 2271