View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-4 (Length: 176)

Name: NF2496-1-Insertion-4
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2496-1-Insertion-4
NF2496-1-Insertion-4
[»] chr7 (1 HSPs)
chr7 (1-176)||(42929483-42929658)
[»] chr1 (2 HSPs)
chr1 (25-119)||(50463289-50463383)
chr1 (22-97)||(25531024-25531099)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 4e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 4e-95
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 42929658 - 42929483
Alignment:
1 gaagcaaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42929658 gaagcaaatgtaagaccaaccaataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctctt 42929559  T
101 gaagaccttcccaatctttaacatcgtgagcttctactatttcctccatagactttcgaaaatcgacataaggatc 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42929558 gaagaccttcccaatctttaacatcgtgagcttctactatttcctccatagactttcgaaaatcgacataaggatc 42929483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 4e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 25 - 119
Target Start/End: Original strand, 50463289 - 50463383
Alignment:
25 aaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagctcttgaagaccttcccaatcttt 119  Q
    |||||||||||||||||||||||| | ||||||||  ||||  |||| || |||||||||||||||||||||||||  | ||| |||||||||||    
50463289 aaatcaacaaaagcaccaacaataaacccatgattatttttaccattaactttcaaataccaactcaaaagctcttccaaaccatcccaatcttt 50463383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 22 - 97
Target Start/End: Original strand, 25531024 - 25531099
Alignment:
22 aataaatcaacaaaagcaccaacaatatagccatgattgattttctcattgaccttcaaataccaactcaaaagct 97  Q
    |||||||||| ||||||| ||| |||| | ||||||||  |||||||||| || |  |||||||||||||||||||    
25531024 aataaatcaaaaaaagcatcaataataaatccatgatttcttttctcattaacttcaaaataccaactcaaaagct 25531099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC