View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-5 (Length: 60)

Name: NF2496-1-Insertion-5
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF2496-1-Insertion-5
[»] chr4 (1 HSPs)
chr4 (1-60)||(33556363-33556422)

Alignment Details
Target: chr4 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33556363 - 33556422
1 gtttccccaatctgttatgaattgttgctcacatgaaacaaaaatatgtccttaaaatct 60  Q
33556363 gtttccccaatctgttatgaattgttgctcacatgaaacaaaaatatgtccttaaaatct 33556422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC