View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2496-1-Insertion-6 (Length: 77)

Name: NF2496-1-Insertion-6
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF2496-1-Insertion-6
[»] chr7 (1 HSPs)
chr7 (1-77)||(36357536-36357608)

Alignment Details
Target: chr7 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 36357536 - 36357608
1 ctaatgtactccagcagggtgcatatgttagcgctcttattgattaaagacaccaccaaatagtggaatagagattt 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||   |||||||||||| |||||||||||    
36357536 ctaatgtactccagcagggtgcatatgttagcgctcttattgatt-aaga---caccaaatagtgcaatagagattt 36357608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC