View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4391-Insertion-1 (Length: 1070)

Name: NF4391-Insertion-1
Description: NF4391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4391-Insertion-1
NF4391-Insertion-1
[»] chr3 (1 HSPs)
chr3 (6-1053)||(51578301-51579358)
[»] chr1 (2 HSPs)
chr1 (509-571)||(302530-302592)
chr1 (126-169)||(303433-303476)


Alignment Details
Target: chr3 (Bit Score: 752; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 752; E-Value: 0
Query Start/End: Original strand, 6 - 1053
Target Start/End: Complemental strand, 51579358 - 51578301
Alignment:
6 caagattttcatcaatcacgtcatatatatatagtgtggataaaattggttatttgcttttagcatagattacatgaattcactaaatcttctgatatgc 105  Q
    |||||||||||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
51579358 caagattttcatcaatcacgtcatatatata--gtgtggataaaattggttatttgtttttagcatagattacataaattcactaaatcttctgatatgc 51579261  T
106 ttgaattttaccatttgacattttcttaatatgcagaaggtgtgcgtgctggattcaaggcagccggcattggatgcgtgaccagtaccgtgcctactgt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||    
51579260 ttgaattttaccatttgacattttcttaatatgcagaaggtgtgcgtgctggattcaaggcagccggcatcggatgcgtgaccagtaccgggcctactgt 51579161  T
206 acgtaattttttagatggacaaaacttagctgcattttcttaggtgttttttcatttgcttcttgactaaaaatacnnnnnnnnnnnnn--gctataaca 303  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||               ||| |||||    
51579160 acgtaattttttagatggacaaaacttagctgcattttcttaggtgttttttcatttgcttcttgactaaaaatacattttttttttttttgctttaaca 51579061  T
304 aacttcnnnnnnnttatggatttgagaaaattatgtatagtttagttaagaaccatatgaatgtccttagatccttaaaggatttatgttctgnnnnnnn 403  Q
    ||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           
51579060 aacttcaaaaaaattatggatttgagaaaattatgtatagtttagttaagaaccatatgaatgtccttagatccttaaaggatttatgttctgttttttt 51578961  T
404 nncttctaactacacttatgaaccttatctgttacatatgagctattttttaatgttgagctttacaaaattcacagttggttgcagttaggatgattcc 503  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51578960 ---ttctaactacacttatgaaccttatctgttacatatgagctattttttaatgttgagctttacaaaattcacagttggttgcagttaggatgattcc 51578864  T
504 atggg---aggcaaacctcaattatactgctcaggcgcttatcatatctgctggtgcgatctcaacttaaatatgtgttacaagagcacttcgatcactg 600  Q
    |||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
51578863 atgggcaaaggcaaacctcaattatactgctcaggcgcttatcatatctgctggtgcgatctcaacttaaatttgtgttacaagagcacttcgatcactg 51578764  T
601 atcagttatatgttatcaaagtcagagagaacttcgatnnnnnnnntgccaccaaatttttaattaataggagtaaaagtgcagcgttgttggtattaat 700  Q
    ||||||||||||||||||||||||||||||||||| ||        ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
51578763 atcagttatatgttatcaaagtcagagagaacttcaataaaaaaaatgccaccaaatttttaattaataggagtaaaagtgtagcgttgttggtattaat 51578664  T
701 gtatcnnnnnnnnagttaacaatctcattccactgtggaaagggactcgactaatcaagagtttgattgaaagttaagtaaaatctaacagattctactt 800  Q
    |||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51578663 gtatcttttttttagttaacaatctcattccactgtggaaagggactcgactaatcaagagtttgattgaaagttaagtaaaatctaacagattctactt 51578564  T
801 aaagataaaattcattaatcacttgaaccctaatgcttggtttacaagttacaacttattcttaattactaactgtatttaaaatagaattgattgtcac 900  Q
    |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51578563 aaagataaaattcattaatcacttgaaccctattacttggtttacaagttacaacttattcttaattactaactgtatttaaaatagaattgattgtcac 51578464  T
901 tgtatg-tatatatgaaattctaattttgataatatagtgg-ttttggttg-tttacatgcagtatctg-tgcatca-tctttg-tgctgctgac-aaac 993  Q
    |||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||| ||| |||||| |||||||||| |||     
51578463 tgtatgttatatatgaaattctaattttgataatatagtggtttttggttgttttacatgcagtatctgttgcgtcattctttgttgctgctgacaaaat 51578364  T
994 tatcttggc-tgtgc-agaaaac-atccctactgctagaagagtctctgaaacaagaaagatg 1053  Q
    ||||||||| ||||| ||||||| |||||||||||||||||| ||||||||||||||||||||    
51578363 tatcttggcttgtgcaagaaaacaatccctactgctagaagaatctctgaaacaagaaagatg 51578301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 509 - 571
Target Start/End: Complemental strand, 302592 - 302530
Alignment:
509 aggcaaacctcaattatactgctcaggcgcttatcatatctgctggtgcgatctcaacttaaa 571  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||  |||||| |||||||    
302592 aggcaaacctcaattataccgctcaggcacttatcatatctgctggtatgatctcgacttaaa 302530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 126 - 169
Target Start/End: Complemental strand, 303476 - 303433
Alignment:
126 ttttcttaatatgcagaaggtgtgcgtgctggattcaaggcagc 169  Q
    ||||||| | ||||||||||||||||||||||||||||||||||    
303476 ttttcttgaaatgcagaaggtgtgcgtgctggattcaaggcagc 303433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109721 times since January 2019
Visitors: 1349