View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4391-Insertion-2 (Length: 557)

Name: NF4391-Insertion-2
Description: NF4391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4391-Insertion-2
[»] chr7 (3 HSPs)
chr7 (7-551)||(36531482-36532026)
chr7 (7-544)||(36537094-36537631)
chr7 (7-546)||(36524649-36525188)
[»] chr5 (6 HSPs)
chr5 (231-507)||(42055849-42056125)
chr5 (388-507)||(42080999-42081118)
chr5 (388-506)||(42072052-42072170)
chr5 (90-186)||(42072498-42072594)
chr5 (116-186)||(42056294-42056364)
chr5 (116-186)||(42081432-42081502)

Alignment Details
Target: chr7 (Bit Score: 493; Significance: 0; HSPs: 3)
Name: chr7

Target: chr7; HSP #1
Raw Score: 493; E-Value: 0
Query Start/End: Original strand, 7 - 551
Target Start/End: Original strand, 36531482 - 36532026
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||            |||||||||||||||||||||||||||||||    
36531482 agctagctacaaagactacgaaaaagaattgcagcctggatgttcctcctcgaggccttttttctttttcatgaaatgctctaaatagagaaacctgcac 36531581  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
36531582 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 36531681  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36531682 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacaccactagatcccgagctagcaaagatgg 36531781  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
36531782 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 36531881  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531882 cataagtttcccaagtggcagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 36531981  T
507 agaatacatgatgctaaccctagaacccatgtccggaatggtagc 551  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
36531982 agaatacatgatgctaaccctagaacccatgtccggaatgttagc 36532026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 7 - 544
Target Start/End: Original strand, 36537094 - 36537631
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||| |||||||||||||||||| || | |||||||  |||||            |||||||||| ||||||| ||| || |||||    
36537094 agctagctacaaagactaagaaaaagaattgcagcctagaagttcctcctttaggccttttttctttttcatgaaatgccctaaataaagacacttgcac 36537193  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||||||    
36537194 aaggatttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccggcccatccatacccaagtatctgagtcgatagcgctaacaaa 36537293  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    |||||||| | |||||||||| | || ||||||||| | |||||||||||||||||||| || ||||| ||||  |||||||| ||| |||||||||||     
36537294 taagccgctatgggatggatgttcctatgatagaaacccttaacaattgtgattatgttaatggcatatacaccgctagatcctgaggtagcaaagatgc 36537393  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
    | ||||| |||||||| |||| |||||||| ||| || ||||||||||||| | |  |||| ||||| |||||||||| |||| ||||||||||||||||    
36537394 tgatcaaaacatgttccttcacagagaatgaccctggattcaacgaaaaagtcaaacttgtgaaagggacttgaattgtttttatgggaagtgttgcagc 36537493  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||    
36537494 cataagtttcccaagtgggagggtaataatctgagctgagacagaagtgattttcaaagggttggttttgtatcctaaaaattggttcataaatgcaagg 36537593  T
507 agaatacatgatgctaaccctagaacccatgtccggaa 544  Q
    || | |||||||||||||||||||||||||||||||||    
36537594 agcacacatgatgctaaccctagaacccatgtccggaa 36537631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 7 - 546
Target Start/End: Original strand, 36524649 - 36525188
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||||| |||||||||||||||| || | |||||||  |||||            |||||||||| ||||||||||| || |||||    
36524649 agctagctacaaagactacggaaaagaattgcagcctagaagttcctcctttaggccttttttctttttcatgaaatgccctaaatagagagacttgcac 36524748  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||    
36524749 aaggttttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaataccagcccatccataccctagcatttgagtcgatagcgctaacaaa 36524848  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    |||||||| || ||||| ||   | ||||||| ||||| ||||||||||||| |||    |||||||| |||||  ||||||| ||||||||||||||||    
36524849 taagccgctactggatgtatatctttgtgataaaaagccttaacaattgtgactatcccaattgcatatacactgttagatcctgagctagcaaagatgg 36524948  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
    | ||||||||||||||||||||||||||||||||||| ||||| |||||| | || ||||| ||||| | ||||||||||||||||||||||||||||||    
36524949 tgatcaacacatgttctttcaaagagaatggccccggattcaaagaaaaataacaggttgtgaaagggatttgaattggttttgtgggaagtgttgcagc 36525048  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    ||||||  | ||||||||||| |  || |||||||| || |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
36525049 cataagccttccaagtgggagtgtgatgatctgagctgaaacagaagtgattctcaaagggttggttctgtagcctaagaactggttcacaaatgcaagg 36525148  T
507 agaatacatgatgctaaccctagaacccatgtccggaatg 546  Q
    || | |||||| ||||| ||||||| |||||||| |||||    
36525149 agcacacatgaagctaagcctagaatccatgtcctgaatg 36525188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 2e-23; HSPs: 6)
Name: chr5

Target: chr5; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 231 - 507
Target Start/End: Complemental strand, 42056125 - 42055849
231 ctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatggtaatcaacacatgttctttcaaag 330  Q
    ||||| |||||||| |||||||| ||||| ||||| || ||||||||||  | || ||| |  ||||||||||||||||| |   ||||||| ||||||     
42056125 ctgtggtagaaagccttaacaatagtgataatgttaatggcataaacaccgccagctccagcactagcaaagatggtaatgagggcatgttccttcaaat 42056026  T
331 agaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagccataagtttcccaagtgggagggc 430  Q
     |||||| || || ||||| |  ||||||||| | || || || |||| |  |  | |||| ||||||||||||||||| ||||| |||| |||||| |     
42056025 tgaatggtccaggattcaatgtgaaagaccatttagtgaagggaactttatatattgttgttggaagtgttgcagccattagttttccaattgggagaga 42055926  T
431 aataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagga 507  Q
    || |||||| || ||||||| ||||||  ||| ||||||||||||||| || || || ||||||||||| |||||||    
42055925 aacaatctgtgctgagacagcagtgatagtcagagggttggttctgtacccaaagaattggttcacaaaggcaagga 42055849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 388 - 507
Target Start/End: Complemental strand, 42081118 - 42080999
388 ttgtgggaagtgttgcagccataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaa 487  Q
    |||| ||||||||||||||||| ||||| |||| |||||| | || |||||| || ||||||| ||||||  ||| ||||||||||||||| || || ||    
42081118 ttgttggaagtgttgcagccattagttttccaattgggagagaaacaatctgtgctgagacagcagtgatagtcagagggttggttctgtacccaaagaa 42081019  T
488 ctggttcacaaatgcaagga 507  Q
     ||||||||||| |||||||    
42081018 ttggttcacaaaggcaagga 42080999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 388 - 506
Target Start/End: Complemental strand, 42072170 - 42072052
388 ttgtgggaagtgttgcagccataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaa 487  Q
    |||| ||||||||||||||||| ||||| |||| |||||| ||||||||||| || ||||||||||| ||   || ||||||||||||| | || || ||    
42072170 ttgttggaagtgttgcagccattagttttccaactgggagagcaataatctgtgctgagacagaagtaatagacagagggttggttctgaatccaaagaa 42072071  T
488 ctggttcacaaatgcaagg 506  Q
     ||||||||||| ||||||    
42072070 ttggttcacaaaggcaagg 42072052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 90 - 186
Target Start/End: Complemental strand, 42072594 - 42072498
90 aatagagaaacctgcacaaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    ||||| || ||||| |||||  ||| ||||||||||||||| || || || |||||||||||||||||||| |||||||||||||| || |||||||    
42072594 aatagtgacacctggacaagatttttaggccaccacatgtagggagagtccacaaggaaccttctgaaaataccagcccatccataaccaagcatct 42072498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 116 - 186
Target Start/End: Complemental strand, 42056364 - 42056294
116 aggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    ||||||||||||||| || || || ||||||||||||||||| || |||||||||||||| || |||||||    
42056364 aggccaccacatgtagggagagtccacaaggaaccttctgaacataccagcccatccataaccaagcatct 42056294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 116 - 186
Target Start/End: Complemental strand, 42081502 - 42081432
116 aggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    |||||||||||| ||||| || || |||||||| ||||||||||| |||||||||||||| || |||||||    
42081502 aggccaccacatataaggagagtccacaaggaatcttctgaaaataccagcccatccataaccaagcatct 42081432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125386 times since January 2019
Visitors: 1457