View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4391-Insertion-2 (Length: 557)

Name: NF4391-Insertion-2
Description: NF4391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4391-Insertion-2
NF4391-Insertion-2
[»] chr7 (3 HSPs)
chr7 (7-551)||(36531482-36532026)
chr7 (7-544)||(36537094-36537631)
chr7 (7-546)||(36524649-36525188)
[»] chr5 (6 HSPs)
chr5 (231-507)||(42055849-42056125)
chr5 (388-507)||(42080999-42081118)
chr5 (388-506)||(42072052-42072170)
chr5 (90-186)||(42072498-42072594)
chr5 (116-186)||(42056294-42056364)
chr5 (116-186)||(42081432-42081502)


Alignment Details
Target: chr7 (Bit Score: 493; Significance: 0; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 493; E-Value: 0
Query Start/End: Original strand, 7 - 551
Target Start/End: Original strand, 36531482 - 36532026
Alignment:
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||            |||||||||||||||||||||||||||||||    
36531482 agctagctacaaagactacgaaaaagaattgcagcctggatgttcctcctcgaggccttttttctttttcatgaaatgctctaaatagagaaacctgcac 36531581  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531582 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 36531681  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36531682 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacaccactagatcccgagctagcaaagatgg 36531781  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531782 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 36531881  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36531882 cataagtttcccaagtggcagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 36531981  T
507 agaatacatgatgctaaccctagaacccatgtccggaatggtagc 551  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
36531982 agaatacatgatgctaaccctagaacccatgtccggaatgttagc 36532026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 7 - 544
Target Start/End: Original strand, 36537094 - 36537631
Alignment:
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||| |||||||||||||||||| || | |||||||  |||||            |||||||||| ||||||| ||| || |||||    
36537094 agctagctacaaagactaagaaaaagaattgcagcctagaagttcctcctttaggccttttttctttttcatgaaatgccctaaataaagacacttgcac 36537193  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||| ||||||    
36537194 aaggatttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccggcccatccatacccaagtatctgagtcgatagcgctaacaaa 36537293  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    |||||||| | |||||||||| | || ||||||||| | |||||||||||||||||||| || ||||| ||||  |||||||| ||| |||||||||||     
36537294 taagccgctatgggatggatgttcctatgatagaaacccttaacaattgtgattatgttaatggcatatacaccgctagatcctgaggtagcaaagatgc 36537393  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
    | ||||| |||||||| |||| |||||||| ||| || ||||||||||||| | |  |||| ||||| |||||||||| |||| ||||||||||||||||    
36537394 tgatcaaaacatgttccttcacagagaatgaccctggattcaacgaaaaagtcaaacttgtgaaagggacttgaattgtttttatgggaagtgttgcagc 36537493  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||    
36537494 cataagtttcccaagtgggagggtaataatctgagctgagacagaagtgattttcaaagggttggttttgtatcctaaaaattggttcataaatgcaagg 36537593  T
507 agaatacatgatgctaaccctagaacccatgtccggaa 544  Q
    || | |||||||||||||||||||||||||||||||||    
36537594 agcacacatgatgctaaccctagaacccatgtccggaa 36537631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 7 - 546
Target Start/End: Original strand, 36524649 - 36525188
Alignment:
7 agctagctacaaagactacgaaaaagaattgcagcctggatggtcctcctcgaggccnnnnnnnnnnnncatgaaatgctctaaatagagaaacctgcac 106  Q
    |||||||||||||||||||| |||||||||||||||| || | |||||||  |||||            |||||||||| ||||||||||| || |||||    
36524649 agctagctacaaagactacggaaaagaattgcagcctagaagttcctcctttaggccttttttctttttcatgaaatgccctaaatagagagacttgcac 36524748  T
107 aaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatctgagtcgatagcgccaacaaa 206  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||    
36524749 aaggttttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaataccagcccatccataccctagcatttgagtcgatagcgctaacaaa 36524848  T
207 taagccgcgacgggatggatgcttctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatgg 306  Q
    |||||||| || ||||| ||   | ||||||| ||||| ||||||||||||| |||    |||||||| |||||  ||||||| ||||||||||||||||    
36524849 taagccgctactggatgtatatctttgtgataaaaagccttaacaattgtgactatcccaattgcatatacactgttagatcctgagctagcaaagatgg 36524948  T
307 taatcaacacatgttctttcaaagagaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagc 406  Q
    | ||||||||||||||||||||||||||||||||||| ||||| |||||| | || ||||| ||||| | ||||||||||||||||||||||||||||||    
36524949 tgatcaacacatgttctttcaaagagaatggccccggattcaaagaaaaataacaggttgtgaaagggatttgaattggttttgtgggaagtgttgcagc 36525048  T
407 cataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagg 506  Q
    ||||||  | ||||||||||| |  || |||||||| || |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
36525049 cataagccttccaagtgggagtgtgatgatctgagctgaaacagaagtgattctcaaagggttggttctgtagcctaagaactggttcacaaatgcaagg 36525148  T
507 agaatacatgatgctaaccctagaacccatgtccggaatg 546  Q
    || | |||||| ||||| ||||||| |||||||| |||||    
36525149 agcacacatgaagctaagcctagaatccatgtcctgaatg 36525188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 2e-23; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 231 - 507
Target Start/End: Complemental strand, 42056125 - 42055849
Alignment:
231 ctgtgatagaaagctttaacaattgtgattatgttgattgcataaacactactagatcccgagctagcaaagatggtaatcaacacatgttctttcaaag 330  Q
    ||||| |||||||| |||||||| ||||| ||||| || ||||||||||  | || ||| |  ||||||||||||||||| |   ||||||| ||||||     
42056125 ctgtggtagaaagccttaacaatagtgataatgttaatggcataaacaccgccagctccagcactagcaaagatggtaatgagggcatgttccttcaaat 42056026  T
331 agaatggccccgggttcaacgaaaaagaccatgttgtaaaaggtacttgaattggttttgtgggaagtgttgcagccataagtttcccaagtgggagggc 430  Q
     |||||| || || ||||| |  ||||||||| | || || || |||| |  |  | |||| ||||||||||||||||| ||||| |||| |||||| |     
42056025 tgaatggtccaggattcaatgtgaaagaccatttagtgaagggaactttatatattgttgttggaagtgttgcagccattagttttccaattgggagaga 42055926  T
431 aataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaactggttcacaaatgcaagga 507  Q
    || |||||| || ||||||| ||||||  ||| ||||||||||||||| || || || ||||||||||| |||||||    
42055925 aacaatctgtgctgagacagcagtgatagtcagagggttggttctgtacccaaagaattggttcacaaaggcaagga 42055849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 388 - 507
Target Start/End: Complemental strand, 42081118 - 42080999
Alignment:
388 ttgtgggaagtgttgcagccataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaa 487  Q
    |||| ||||||||||||||||| ||||| |||| |||||| | || |||||| || ||||||| ||||||  ||| ||||||||||||||| || || ||    
42081118 ttgttggaagtgttgcagccattagttttccaattgggagagaaacaatctgtgctgagacagcagtgatagtcagagggttggttctgtacccaaagaa 42081019  T
488 ctggttcacaaatgcaagga 507  Q
     ||||||||||| |||||||    
42081018 ttggttcacaaaggcaagga 42080999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 388 - 506
Target Start/End: Complemental strand, 42072170 - 42072052
Alignment:
388 ttgtgggaagtgttgcagccataagtttcccaagtgggagggcaataatctgagccgagacagaagtgattttcaaagggttggttctgtagcctaaaaa 487  Q
    |||| ||||||||||||||||| ||||| |||| |||||| ||||||||||| || ||||||||||| ||   || ||||||||||||| | || || ||    
42072170 ttgttggaagtgttgcagccattagttttccaactgggagagcaataatctgtgctgagacagaagtaatagacagagggttggttctgaatccaaagaa 42072071  T
488 ctggttcacaaatgcaagg 506  Q
     ||||||||||| ||||||    
42072070 ttggttcacaaaggcaagg 42072052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 90 - 186
Target Start/End: Complemental strand, 42072594 - 42072498
Alignment:
90 aatagagaaacctgcacaaggctttcaggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    ||||| || ||||| |||||  ||| ||||||||||||||| || || || |||||||||||||||||||| |||||||||||||| || |||||||    
42072594 aatagtgacacctggacaagatttttaggccaccacatgtagggagagtccacaaggaaccttctgaaaataccagcccatccataaccaagcatct 42072498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 116 - 186
Target Start/End: Complemental strand, 42056364 - 42056294
Alignment:
116 aggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    ||||||||||||||| || || || ||||||||||||||||| || |||||||||||||| || |||||||    
42056364 aggccaccacatgtagggagagtccacaaggaaccttctgaacataccagcccatccataaccaagcatct 42056294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 116 - 186
Target Start/End: Complemental strand, 42081502 - 42081432
Alignment:
116 aggccaccacatgtaaggtgaatcaacaaggaaccttctgaaaatcccagcccatccataccctagcatct 186  Q
    |||||||||||| ||||| || || |||||||| ||||||||||| |||||||||||||| || |||||||    
42081502 aggccaccacatataaggagagtccacaaggaatcttctgaaaataccagcccatccataaccaagcatct 42081432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 318688 times since January 2019
Visitors: 3039