View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398-Insertion-2 (Length: 1041)

Name: NF4398-Insertion-2
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398-Insertion-2
[»] chr8 (21 HSPs)
chr8 (8-965)||(23288558-23289528)
chr8 (689-990)||(23390551-23390858)
chr8 (387-617)||(9235357-9235587)
chr8 (8-140)||(23390166-23390301)
chr8 (407-519)||(24375774-24375883)
chr8 (387-501)||(28786366-28786480)
chr8 (145-248)||(23390340-23390442)
chr8 (399-501)||(23245677-23245779)
chr8 (387-617)||(5600186-5600413)
chr8 (387-617)||(5640207-5640434)
chr8 (390-487)||(11908468-11908565)
chr8 (414-605)||(24528821-24529011)
chr8 (387-498)||(13373240-13373351)
chr8 (431-605)||(14698115-14698287)
chr8 (407-466)||(8980741-8980800)
chr8 (325-441)||(13980022-13980135)
chr8 (245-282)||(23390509-23390546)
chr8 (427-487)||(12719189-12719249)
chr8 (551-605)||(9305645-9305699)
chr8 (551-605)||(34227409-34227463)
chr8 (552-605)||(31974930-31974983)
[»] chr2 (17 HSPs)
chr2 (387-617)||(42223095-42223325)
chr2 (387-501)||(11915174-11915288)
chr2 (387-611)||(41906067-41906289)
chr2 (387-519)||(35791134-35791264)
chr2 (387-501)||(11478052-11478166)
chr2 (387-501)||(16590603-16590716)
chr2 (407-501)||(31989508-31989602)
chr2 (407-519)||(31377688-31377798)
chr2 (387-487)||(31397428-31397528)
chr2 (413-484)||(29878811-29878882)
chr2 (387-487)||(41567315-41567415)
chr2 (441-519)||(13315985-13316060)
chr2 (442-501)||(23381344-23381403)
chr2 (324-363)||(42223029-42223068)
chr2 (387-441)||(16590512-16590566)
chr2 (551-605)||(18756588-18756642)
chr2 (408-470)||(24486596-24486658)
[»] chr7 (22 HSPs)
chr7 (322-606)||(1853183-1853463)
chr7 (387-606)||(42957424-42957643)
chr7 (323-539)||(9689223-9689438)
chr7 (388-519)||(2936188-2936316)
chr7 (388-611)||(43393784-43394007)
chr7 (387-617)||(3092292-3092521)
chr7 (427-538)||(11625113-11625222)
chr7 (387-519)||(24812901-24813032)
chr7 (387-499)||(25601798-25601910)
chr7 (390-611)||(15635163-15635384)
chr7 (391-519)||(45687693-45687818)
chr7 (387-501)||(27082594-27082708)
chr7 (387-501)||(27195593-27195707)
chr7 (387-483)||(19377094-19377191)
chr7 (390-501)||(15011955-15012066)
chr7 (387-501)||(27484945-27485060)
chr7 (405-501)||(22859340-22859435)
chr7 (390-501)||(22610110-22610223)
chr7 (387-439)||(3092476-3092527)
chr7 (524-602)||(17155693-17155771)
chr7 (442-487)||(10975724-10975769)
chr7 (452-501)||(14675639-14675688)
[»] chr4 (19 HSPs)
chr4 (323-603)||(8809963-8810242)
chr4 (323-539)||(13555600-13555815)
chr4 (387-616)||(5283672-5283900)
chr4 (387-501)||(9780392-9780506)
chr4 (394-617)||(42161286-42161509)
chr4 (387-501)||(16875937-16876051)
chr4 (387-523)||(16734215-16734350)
chr4 (387-495)||(49277727-49277835)
chr4 (323-486)||(8678824-8678989)
chr4 (387-501)||(49533218-49533332)
chr4 (407-469)||(25786326-25786388)
chr4 (388-501)||(21744885-21744998)
chr4 (524-605)||(32681909-32681990)
chr4 (407-501)||(29172622-29172715)
chr4 (387-441)||(29700563-29700617)
chr4 (387-439)||(23091876-23091928)
chr4 (390-501)||(37589461-37589572)
chr4 (524-605)||(7913324-7913405)
chr4 (524-605)||(21507908-21507989)
[»] chr3 (18 HSPs)
chr3 (387-523)||(7308175-7308308)
chr3 (323-538)||(55257638-55257854)
chr3 (387-528)||(43426365-43426505)
chr3 (387-605)||(17030611-17030828)
chr3 (427-617)||(25124872-25125061)
chr3 (387-519)||(18359295-18359424)
chr3 (387-502)||(25159014-25159129)
chr3 (387-538)||(17582462-17582613)
chr3 (387-494)||(7013229-7013336)
chr3 (387-501)||(23070058-23070172)
chr3 (387-501)||(45008061-45008176)
chr3 (387-471)||(5303666-5303750)
chr3 (390-519)||(30226239-30226366)
chr3 (405-501)||(37050166-37050262)
chr3 (540-611)||(17582239-17582310)
chr3 (427-494)||(20275533-20275600)
chr3 (320-368)||(7308039-7308088)
chr3 (324-361)||(25158790-25158827)
[»] chr5 (12 HSPs)
chr5 (387-616)||(20355086-20355314)
chr5 (387-617)||(42778875-42779107)
chr5 (387-527)||(21144023-21144161)
chr5 (387-523)||(13153599-13153733)
chr5 (387-501)||(15399676-15399792)
chr5 (387-539)||(37869460-37869611)
chr5 (407-501)||(17668736-17668830)
chr5 (407-483)||(31567804-31567880)
chr5 (405-443)||(21125336-21125374)
chr5 (387-441)||(21144205-21144258)
chr5 (551-605)||(31312692-31312746)
chr5 (551-611)||(18231998-18232059)
[»] chr1 (20 HSPs)
chr1 (390-605)||(25059868-25060082)
chr1 (387-519)||(13436988-13437117)
chr1 (387-603)||(5469375-5469592)
chr1 (387-538)||(17890132-17890281)
chr1 (387-501)||(33864207-33864321)
chr1 (387-501)||(33916601-33916715)
chr1 (387-519)||(44228414-44228543)
chr1 (387-487)||(7261487-7261587)
chr1 (387-523)||(9240602-9240736)
chr1 (322-455)||(22315143-22315278)
chr1 (407-501)||(22151973-22152067)
chr1 (387-469)||(44078716-44078798)
chr1 (407-471)||(5883012-5883076)
chr1 (387-422)||(5469355-5469390)
chr1 (413-501)||(23652563-23652647)
chr1 (583-617)||(1701191-1701225)
chr1 (431-523)||(16639582-16639673)
chr1 (413-471)||(23621217-23621275)
chr1 (413-471)||(23737996-23738054)
chr1 (387-436)||(18426734-18426783)
[»] chr6 (9 HSPs)
chr6 (407-539)||(9662836-9662966)
chr6 (390-501)||(25167039-25167150)
chr6 (387-606)||(9044480-9044699)
chr6 (387-501)||(3816552-3816665)
chr6 (391-497)||(20757595-20757700)
chr6 (390-470)||(33198591-33198671)
chr6 (387-494)||(334912-335019)
chr6 (407-487)||(6759744-6759824)
chr6 (387-441)||(33200013-33200067)
[»] scaffold0067 (1 HSPs)
scaffold0067 (321-524)||(25844-26044)
[»] scaffold0004 (1 HSPs)
scaffold0004 (390-532)||(82304-82444)
[»] scaffold0188 (1 HSPs)
scaffold0188 (387-484)||(13286-13384)
[»] scaffold0142 (2 HSPs)
scaffold0142 (447-617)||(34884-35054)
scaffold0142 (387-451)||(34500-34564)
[»] scaffold0110 (1 HSPs)
scaffold0110 (408-501)||(23194-23287)
[»] scaffold0003 (2 HSPs)
scaffold0003 (407-487)||(306678-306757)
scaffold0003 (389-501)||(316587-316699)

Alignment Details
Target: chr8 (Bit Score: 668; Significance: 0; HSPs: 21)
Name: chr8

Target: chr8; HSP #1
Raw Score: 668; E-Value: 0
Query Start/End: Original strand, 8 - 965
Target Start/End: Complemental strand, 23289528 - 23288558
8 ataaataggttggaaaagtgtcaaatcctgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 107  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23289528 ataaataggttggaaaagtatcaaatcttgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 23289429  T
108 ctacaaagaaattaatatgacaaatcgatcatcatttatttatactgttagagactataatatgataaacatgtcacatataatattgatcccacatcaa 207  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| ||||    
23289428 ctacaaagaaagcaatatgacaaatcgatcatcatttatttatactgttagagactataatattataaacatgtcacatttaatattgatcacacgtcaa 23289329  T
208 tacaatcatctaatccatttgggttggtttggtggagttgtagatgactacatattgcgtcataaactcgaacctaaaagctaacatacggatcatttgg 307  Q
    |||||||||||||  ||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
23289328 tacaatcatctaactcatttggattggtatggtggtgttgtagatgactacatattgcgtcataaactcgaacctaaaagctagcatacggatcatttgg 23289229  T
308 actcataagagttaaagggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||  | |||||         ||||||||||||||||||| |    
23289228 actcataagagttaaagggttaatatatgtttgcccctgtaatattagtgattttcggtttatcccctgt-aaaaaaaattgtttagattccaaccctgt 23289130  T
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaat-ccc 506  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||    
23289129 aatttgaagattttttaactttggaccttcatggcatcaaattacaaaatttaaggtactttcgtcccctgtaatttgagagaatttctgtttaatcccc 23289030  T
507 cctgtcatatcattgatatttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacag 606  Q
    ||||||||||||| ||||||||||||||||| |||||||||| ||||||||||  ||||||||| |||||||| |||||||||||||||| |||||||||    
23289029 cctgtcatatcatcgatatttcggttcaccctcgctatatcattgattttgtacggtcaatattcatgaagttctaaaaccaaaaatcttcaaattacag 23288930  T
607 cgttgaaatct---nnnnnnnnnttacaatggataaatcgaaaatctctaatattac-agggtaaaca-----taacccagagttaaatgtaccaacttg 697  Q
      |||||||||            |||||||||||||| || |||||||||||||||| || |||||||     |||||||||||||||||||||||||||    
23288929 gattgaaatctaaaaaaaaaaaattacaatggataaaccggaaatctctaatattacaagagtaaacatatattaacccagagttaaatgtaccaacttg 23288830  T
698 cctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaatgtcatttc 797  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
23288829 cctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccggcgctgacttcttaaatgtcatttc 23288730  T
798 tatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaattctaatccag 897  Q
23288729 tatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaattctaatccag 23288630  T
898 gt-cactctctttcttctata--cagaaacaacacatttgcacca-cttgtctatctacttgagtacggaaa 965  Q
    || |||||||| |||||||||   ||||||| ||||||||||||| ||||||| ||||||||||||| ||||    
23288629 gtccactctctgtcttctataacaagaaacagcacatttgcaccaccttgtctgtctacttgagtacagaaa 23288558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 225; E-Value: 1e-123
Query Start/End: Original strand, 689 - 990
Target Start/End: Original strand, 23390551 - 23390858
689 accaacttgcctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaa 788  Q
    ||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23390551 accaacttgcctattcaatcaataaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaa 23390650  T
789 tgtcatttctatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaatt 888  Q
    |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23390651 tgtcatttctatttaatatggtctctaactgggtaaggaaattttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaatt 23390750  T
889 ctaatccaggt-cactctctttcttctata--cagaaacaacacatttgcacca-cttgtctatctacttgagtac-ggaaagtagctaggaa-taaaat 982  Q
    ||||||||||| ||||||||||||||||||   ||||||| ||||||||||||| ||||||||||||||||||||| | ||||| |||| ||| ||||||    
23390751 ctaatccaggtccactctctttcttctataacaagaaacagcacatttgcaccaccttgtctatctacttgagtacagaaaagttgctacgaattaaaat 23390850  T
983 ataaaaaa 990  Q
23390851 ataaaaaa 23390858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 6e-46
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 9235587 - 9235357
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| ||||||||||    
9235587 ttgtttagatttcaaccctgtaatttgaagattttttgattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttga 9235488  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcac--ccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
     ||||||| |||||||  ||| || |||||||| |||||||||||| ||  ||| |  ||||||  ||||||||| |||||| ||| |||||| |  |||    
9235487 aagaattttggtttaa--cccttgacatatcatcgatatttcggtttaccaccctgtcatatcatcgattttgtacagtcaaaattcatgaaggtccaaa 9235390  T
585 accaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| |||| ||||||||  ||||||||||    
9235389 accaaaattcttcaaattacatggttgaaatct 9235357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 8 - 140
Target Start/End: Original strand, 23390166 - 23390301
8 ataaataggttggaaaagtgtcaaatcctgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 107  Q
    |||| |||||||||||||||||||||| |||  ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||    
23390166 ataagtaggttggaaaagtgtcaaatcttgcatcaaatatagtcaatgatggcttatggaaacggactagaaccatccctataactcatgcattttcatt 23390265  T
108 ctaca---aagaaattaatatgacaaatcgatcatc 140  Q
    |||||   ||||||||||||||||||||| ||||||    
23390266 ctacaaagaagaaattaatatgacaaatcaatcatc 23390301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 407 - 519
Target Start/End: Original strand, 24375774 - 24375883
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    |||||||||||||||||   |||||||||||||| |||||||||||||| |||| |||||||||||||| |||||||||||  |||||| |||||  |||    
24375774 taatttgaagattttttgt-tttggaccttcatggcatcaaattacaaaatttatggtactttcgtcccttgtaatttgagcaaatttcagttta--ccc 24375870  T
507 cctgtcatatcat 519  Q
    |||| ||||||||    
24375871 cctgccatatcat 24375883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 28786366 - 28786480
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||| | ||||||| ||| | |||||||||||||| |||||| || |||| |||||||||||| ||  |||||||||||||    
28786366 ttgtttagattccaaccctgtaactagaagattatttgattttggaccttcatggcatcaattttcaaactttaaggtacttccgctccctgtaatttga 28786465  T
487 gagaatttcggttta 501  Q
    |  ||||| ||||||    
28786466 gcaaattttggttta 28786480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 145 - 248
Target Start/End: Original strand, 23390340 - 23390442
145 atttatactgttagagactataatatgataaacatgtcacatataatattgatcccacatcaatacaatcatctaatccatttgggttggtttggtggag 244  Q
    |||||||| ||||||| ||| ||||||| ||||||||||||| ||| ||| ||||||||||| | | ||||| |||||||||||||||||| |||||| |    
23390340 atttatacggttagaggctacaatatgacaaacatgtcacatttaacatttatcccacatcagt-ccatcatgtaatccatttgggttggtctggtggtg 23390438  T
245 ttgt 248  Q
23390439 ttgt 23390442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 399 - 501
Target Start/End: Complemental strand, 23245779 - 23245677
399 caaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggt 498  Q
    ||||||| ||||||||||||||||| | |||||||||  ||| ||| |||||  ||| ||||||||||||||| ||| |||||||||||| ||||||| |    
23245779 caaccctgtaatttgaagattttttgattttggacctatatggcattaaattttaaaatttaaggtactttcgccccatgtaatttgagataatttcgtt 23245680  T
499 tta 501  Q
23245679 tta 23245677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 5600413 - 5600186
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||  | ||||||| |||||| ||||||| || |||||||||||| ||||| |||||| |    
5600413 ttgtttaaatttcaaccttgtaatttgaagatttttttattttaaatcttcatggcatcaagttacaaaattgaaggtactttcg-cccctataatttta 5600315  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||||||   | ||||||||  |||||||||||| ||| ||| |||| | || |||| |  ||||||||| |||||| ||| || ||| |  ||||    
5600314 gagaatttcgg---attccccctgctatatcattgatagttcagtttaccctctgccatattatcgattttgtacagtcaaaattcataaaggtacaaaa 5600218  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
    | |||||  ||||||||| |  ||||||||||    
5600217 ctaaaaaattttaaattatacggttgaaatct 5600186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 387 - 617
Target Start/End: Original strand, 5640207 - 5640434
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||  | ||||||| |||||| ||||||| || |||||||||||| ||||| |||||| |    
5640207 ttgtttaaatttcaaccttgtaatttgaagatttttttattttaaatcttcatggcatcaagttacaaaattgaaggtactttcg-cccctataatttta 5640305  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||||||   | ||||||||  |||||||||||| ||| ||| |||| | || |||| |  ||||||||| |||||| ||| || ||| |  ||||    
5640306 gagaatttcgg---attccccctgctatatcattgatagttcagtttaccctctgccatattatcgattttgtacagtcaaaattcataaaggtacaaaa 5640402  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
    | |||||  ||||||||| |  ||||||||||    
5640403 ctaaaaaattttaaattatacggttgaaatct 5640434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 390 - 487
Target Start/End: Original strand, 11908468 - 11908565
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||| | ||||||||||||| | |   || ||||||||||| ||||||||| |||| ||||||||||||| |||| ||||||||||||    
11908468 tttagattccaaccatgtaatttgaagattctatggtttaggaccttcatggcatcaaatttcaaaatttaaggtacttttgtcctctgtaatttgag 11908565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 414 - 605
Target Start/End: Complemental strand, 24529011 - 24528821
414 aagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtca 513  Q
    |||||||||| | |||| |||||| || |||||||||| ||| ||||| ||| ||||| ||  |||||||| ||||||| ||||||||  ||||||  ||    
24529011 aagatttttttattttgtaccttcgtggcatcaaattataaaatttaaagtattttcgccctttgtaattttagagaatctcggttta--ccccctacca 24528914  T
514 tatcattgatatttcggttcacccccgcta-tatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||||| |||||||| ||| ||||||  || |||||  ||||||||| |||||| ||| |||||  | ||||||||||||  || ||||||||    
24528913 tatcatcgatatttcagtttaccccctgtaatatcatcgattttgtacagtcaaaattcatgaaaatctaaaaccaaaaagattcaaattaca 24528821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 387 - 498
Target Start/End: Original strand, 13373240 - 13373351
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| |||| || ||||||||||||| |||   |||| |||||| || |||||||||||||| ||||||||| ||| | ||| ||||||||||    
13373240 ttgtttatatttcaactctgtaatttgaagattctttggttttgaaccttcctggcatcaaattacaaaatttaaggtatttttgccccttgtaatttga 13373339  T
487 gagaatttcggt 498  Q
    ||||||| ||||    
13373340 gagaattccggt 13373351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 431 - 605
Target Start/End: Complemental strand, 14698287 - 14698115
431 gaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatttc-g 529  Q
    |||||||||| |||||| ||| ||| ||||||||||||| ||||  |||||||||||| |||||| ||||   ||||||| |||||||| |||||||| |    
14698287 gaccttcatggcatcaa-ttataaaatttaaggtacttttgtcctttgtaatttgagaaaatttcagttt--gccccctgccatatcatcgatatttcag 14698191  T
530 gttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||  |||  || |||||| ||||||||||  ||||| ||| || ||| || ||||  ||||||||| ||||||||    
14698190 gttaccccttgccatatcattgattttgtactgtcaaaattcataaaggttcaaaataaaaaatcttcaaattaca 14698115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 8980800 - 8980741
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtac 466  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||| |||| |||||    
8980800 taatttgaagattctttagttttggaccttcatgacatcaaattacaaaatttatggtac 8980741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 325 - 441
Target Start/End: Complemental strand, 13980135 - 13980022
325 ggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttttta 424  Q
    ||||||||||||||| ||||||||||||||||||||||| |||| || |   |         |||||||||||| |||||| ||||||||||||| |||     
13980135 ggttaatatatgtttacccctgtaatattagtgatttccggtttacccc---ttaaaaaaaattgtttagattctaaccctgtaatttgaagattctttg 13980039  T
425 actttggaccttcatga 441  Q
    | |||||||||||||||    
13980038 attttggaccttcatga 13980022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 245 - 282
Target Start/End: Original strand, 23390509 - 23390546
245 ttgtagatgactacatattgcgtcataaactcgaacct 282  Q
23390509 ttgtagatgactacatattgcgtcataaactcgaacct 23390546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 427 - 487
Target Start/End: Original strand, 12719189 - 12719249
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||||||||||| |||| || | | |||||||| ||| |||||||||||    
12719189 tttggaccttcatgacatcaaatttcaaaattgatgatactttcgccccttgtaatttgag 12719249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 9305645 - 9305699
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| || ||||||||||||||| ||||||||    
9305645 gattttgtacagtcaaaattcatgaaggttcaaaaccaaaaatcttcaaattaca 9305699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Complemental strand, 34227463 - 34227409
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| | |||||||||||||||| ||||||||    
34227463 gattttgtacagtcaaaattcatgaaggtctaaaaccaaaaatcttcaaattaca 34227409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 552 - 605
Target Start/End: Original strand, 31974930 - 31974983
552 attttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||||||| |||||| ||| |||||| || |||||||||||||||| |||||||    
31974930 attttgtacagtcaaaattcatgaaggttcaaaaccaaaaatctttgaattaca 31974983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 103; Significance: 1e-50; HSPs: 17)
Name: chr2

Target: chr2; HSP #1
Raw Score: 103; E-Value: 1e-50
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 42223325 - 42223095
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||||||| | |||| ||||||||| |||||||||||||| ||||||||||||||| ||| ||||||||||    
42223325 ttgtttagattccaaccctgtaatttgaagattttttgattttgaaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttga 42223226  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcac--ccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
     ||||||||||||||  ||||||| ||||||||  ||||||||||| ||  |||  | ||||||  ||||||||| |||||| ||| |||||| |  |||    
42223225 aagaatttcggttta--ccccctgacatatcatcaatatttcggtttaccaccctaccatatcatcgattttgtacagtcaaaattcatgaagatccaaa 42223128  T
585 accaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| |||| ||||||||| ||||||||||    
42223127 accaaaattcttcaaattacagggttgaaatct 42223095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 11915288 - 11915174
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| |||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||| ||||||| ||| ||||||||||    
11915288 ttgtttaaatttcaactctataatttgaagattttttggttttggaccttcatgacatcaaattacaaaatttaaggcactttcgccccgtgtaatttga 11915189  T
487 gagaatttcggttta 501  Q
    |||||||| ||||||    
11915188 gagaattttggttta 11915174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 611
Target Start/End: Complemental strand, 41906289 - 41906067
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||||||||| ||| |||||||||||||| ||| |||||||||||  || |||||  |||    
41906289 ttgtttaaatttcaaccttgtaatttgaagatttttttattttggacctttatggcatcaaattacaaaattttaggtactttcg-accttgtaacatga 41906191  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    ||||||||| |||||  ||||||| ||||||||||||||||| ||| ||||||  | |||||   ||||||||| |||||| ||| |||||| |  ||||    
41906190 gagaatttcagttta--ccccctgccatatcattgatatttcagtttacccccttccatatcgtcgattttgtacagtcaaaattcatgaaggtcgaaaa 41906093  T
586 ccaaaaatctttaaattacagcgttg 611  Q
    ||||| ||||| ||||||||| ||||    
41906092 ccaaatatcttcaaattacagggttg 41906067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 35791264 - 35791134
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||| || |||||| |||||| ||| | |||  ||||||||| |||||||||||||| ||||||||||||||| ||  ||||||||||    
35791264 ttgtttagatttcaactctgtaatttaaagattctttgattttaaaccttcatgccatcaaattacaaaatttaaggtactttcgccctttgtaatttga 35791165  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    ||| |||||||||||  ||||||| ||||||||    
35791164 gagtatttcggttta--ccccctgccatatcat 35791134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 11478052 - 11478166
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||| ||| |||   |||||||||||||  |||||||||||||| ||||||||||||||| | | |||||||||     
11478052 ttgtttagatttcaaccctgtaatttgaaaattctttggttttggaccttcatagcatcaaattacaaaatttaaggtactttcgcctcttgtaatttgg 11478151  T
487 gagaatttcggttta 501  Q
    || ||||||||||||    
11478152 gataatttcggttta 11478166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 16590716 - 16590603
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||| ||| ||||||||||||| |||   ||||||||||||||||||||||||||||| ||||||||||||||| | ||| | ||||||    
16590716 ttgtttatatttcaaacctgtaatttgaagattatttggttttggaccttcatgacatcaaattacaaaatttaaggtactttcgcctcctat-atttga 16590618  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
16590617 gagaatttcgattta 16590603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 501
Target Start/End: Complemental strand, 31989602 - 31989508
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||||||||| |||   |||||||||||||| |||||||||||||| |||| |||||||||| ||||| |||| ||||  |||||| |||||    
31989602 taatttgaagattctttggttttggaccttcatggcatcaaattacaaaatttatggtactttcgccccctataatatgagcaaatttcagttta 31989508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 407 - 519
Target Start/End: Complemental strand, 31377798 - 31377688
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    ||||||||||||| |||   |||||||||||||| ||||| |||||||| ||||  ||||||||| | |||||||||||||  ||||| |||||||  ||    
31377798 taatttgaagattatttggttttggaccttcatggcatcatattacaaaatttatagtactttcgcctcctgtaatttgagcaaattttggtttaa--cc 31377701  T
507 cctgtcatatcat 519  Q
    |||| ||||||||    
31377700 cctgccatatcat 31377688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 387 - 487
Target Start/End: Complemental strand, 31397528 - 31397428
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||  || ||| ||||||||||||| |||   |||||||||||||||| ||||||| |||| |||| | |||||||| ||| ||||||||||    
31397528 ttgtttagattgtaaacctgtaatttgaagattatttggttttggaccttcatgacgtcaaatttcaaaatttatgatactttcgccccttgtaatttga 31397429  T
487 g 487  Q
31397428 g 31397428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 413 - 484
Target Start/End: Original strand, 29878811 - 29878882
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||| ||| | ||||||| |||||| |||||||||||||| |||| |||| ||||||||| ||||||||    
29878811 gaagattctttgattttggacattcatggcatcaaattacaaaatttatggtattttcgtcccttgtaattt 29878882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 487
Target Start/End: Original strand, 41567315 - 41567415
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | ||||||||| ||| ||  | |||||| ||| |||  |||||||| |||| ||||||||||||||| | | ||||||||||    
41567315 ttgtttagatttcaaccttgtaatttgaaaattattcgattttggatctttatggtatcaaatttcaaaatttaaggtactttcgcctcatgtaatttga 41567414  T
487 g 487  Q
41567415 g 41567415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 441 - 519
Target Start/End: Complemental strand, 13316060 - 13315985
441 acatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcat 519  Q
    |||| |||||||||| ||| ||||||||||| ||| |||||||||| ||||||||| ||||  ||||||| ||||||||    
13316060 acattaaattacaaaatttcaggtactttcg-cccatgtaatttgaaagaatttcgattta--ccccctgccatatcat 13315985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 442 - 501
Target Start/End: Complemental strand, 23381403 - 23381344
442 catcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||| |||| |||||||||| ||| |||||||||||  ||||||| ||||    
23381403 catcaaattacaaaatttatggtactttcgccccttgtaatttgagtaaatttcgattta 23381344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 324 - 363
Target Start/End: Original strand, 42223029 - 42223068
324 gggttaatatatgtttgcccctgtaatattagtgatttcc 363  Q
    |||||||||||||||| ||||| |||||||||||||||||    
42223029 gggttaatatatgtttacccctataatattagtgatttcc 42223068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Original strand, 16590512 - 16590566
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    |||||||||||||||| || |||||||||||||||||   |||| ||||||||||    
16590512 ttgtttagattccaactctgtaatttgaagattttttggttttgcaccttcatga 16590566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 18756588 - 18756642
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| |  ||||||||||||||||||||||||    
18756588 gattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatctttaaattaca 18756642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 408 - 470
Target Start/End: Original strand, 24486596 - 24486658
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc 470  Q
    |||||||| ||| ||||  ||||||| |||||||||||||||| |||| |||||| |||||||    
24486596 aatttgaaaattgtttagttttggactttcatgacatcaaatttcaaaatttaagatactttc 24486658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 96; Significance: 2e-46; HSPs: 22)
Name: chr7

Target: chr7; HSP #1
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 322 - 606
Target Start/End: Complemental strand, 1853463 - 1853183
322 aagggttaatatatgtttgcccc-tgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    |||||||||||||||||| |||| |||||||||||||||||   |||| |||| |||         ||||||||||||||||| | ||||||||||||||    
1853463 aagggttaatatatgtttaccccctgtaatattagtgatttttggtttacctcatgtaaaaaaat-ttgtttagattccaaccttgtaatttgaagattt 1853365  T
421 tttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||| | |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |||||||||||||||||  |||  ||||||| | ||||||     
1853364 tttgattttggaccttcatggcatcaaatttcaaaatttaaggtactttcgtcccctgaaatttgagagaatttcg--tta--ccccctgccttatcatc 1853269  T
521 gatatttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacag 606  Q
    ||||||||| ||  |||| |  ||||||  ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||||||    
1853268 gatatttcgtttaccccctgtcatatcatcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatcttcaaattacag 1853183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 387 - 606
Target Start/End: Original strand, 42957424 - 42957643
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| |||||||||  |||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||    
42957424 ttgtttagattctaaccctgtaatttgaattttttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgtcccttgtaatttga 42957523  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttc--ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    |||||||||| ||||  ||| |||||||||| | ||||||||  | | | |||| ||||||||| |||||||||| | ||||  || |||||| |  |||    
42957524 gagaatttcgattta--ccctctgtcatatcctcgatatttcatgttactcccctgctatatcattgattttgtacaatcaaagttcatgaaggtcgaaa 42957621  T
585 accaaaaatctttaaattacag 606  Q
    |||||||||||| |||||||||    
42957622 accaaaaatcttcaaattacag 42957643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 539
Target Start/End: Original strand, 9689223 - 9689438
323 agggttaatatatgtttgccc-ctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttt 421  Q
    ||||||||||||||||| ||| |||||||||||| ||||||| |||| || |||||         ||| ||||||| ||||||| |||||||||||||||    
9689223 agggttaatatatgtttaccctctgtaatattagcgatttccggtttacc-cctgtaaaaaaaatttggttagatttcaaccctgtaatttgaagatttt 9689321  T
422 tta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||  | ||||||||||||||||||||||||| ||| ||||||||||||| ||||| |||||||||||||||||||||||||  ||||||  ||||||||     
9689322 tttgattttggaccttcatgacatcaaattataaaatttaaggtacttttgtcccttgtaatttgagagaatttcggttta--ccccctaccatatcatc 9689419  T
521 gatatttcggttcaccccc 539  Q
     ||||||||||| ||||||    
9689420 aatatttcggtttaccccc 9689438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 388 - 519
Target Start/End: Original strand, 2936188 - 2936316
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||| | ||||||||| ||| |||   ||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||    
2936188 tgtttagattccaaccatgtaatttgaaaattatttggttttagaccttcatgacatcaaattacaaaatttaaggtactttcgccccctgtaatttgag 2936287  T
488 agaatttcggtttaatccccctgtcatatcat 519  Q
    ||||||| ||||||   |||||||||||||||    
2936288 agaatttgggttta---cccctgtcatatcat 2936316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 388 - 611
Target Start/End: Complemental strand, 43394007 - 43393784
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||| ||| ||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| |||||  ||||    
43394007 tgtttaaatttcaaccctgtaatttgaagatttttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgacccttgtaacgtgag 43393908  T
488 agaatttcggtttaatccccctgtcatatcattgatatttcggttca--cccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||| |||||  |||||||  ||| ||| |||||||| ||| |  ||||  | |||||   |||||||||  ||||| ||| |||||  |  ||||    
43393907 agaatttcagttta--ccccctgctataccatcgatatttcagtttatcccccttccatatcgtcgattttgtacggtcaaaattcatgaatgtcaaaaa 43393810  T
586 ccaaaaatctttaaattacagcgttg 611  Q
    ||||||||||||||||||||| ||||    
43393809 ccaaaaatctttaaattacagggttg 43393784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 387 - 617
Target Start/End: Original strand, 3092292 - 3092521
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | |||||| |||||||||| | |||  |||||||| ||||||||||| ||| ||||||||||||||  ||||| ||||||||    
3092292 ttgtttagatttcaaccttgtaatttaaagattttttgattttaaaccttcattacatcaaattataaaatttaaggtactttcaccccctataatttga 3092391  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    ||||||| |||||||  ||||||  |||||||||||||||||| || |||||  |  |||||   ||||||||| |||||| ||| |||||| |  |||     
3092392 gagaattacggttta--cccccttccatatcattgatatttcgatttaccccatgtcatatcgtcgattttgtacagtcaaaattaatgaaggtccaaat 3092489  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
     |||||||||| ||||||||| |||| |||||    
3092490 acaaaaatcttcaaattacagggttggaatct 3092521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 427 - 538
Target Start/End: Complemental strand, 11625222 - 11625113
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatt 526  Q
    ||||||||||||||||||||||||||| | ||||||||||||||| ||| |||| |||| |||||||||||||||  ||||||  |||||||||||||||    
11625222 tttggaccttcatgacatcaaattacataatttaaggtactttcgccccttgtagtttgtgagaatttcggttta--ccccctaccatatcattgatatt 11625125  T
527 tcggttcacccc 538  Q
    |||||| |||||    
11625124 tcggtttacccc 11625113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 24813032 - 24812901
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||||||| |||   ||| |||||| | | |||||||||||||| |||||||||||||| |||| ||||||||||    
24813032 ttgtttagatttcaaccctgtaatttgaagattctttggttttagacctttaaggcatcaaattacaaaatttaaggtactttcatcccttgtaatttga 24812933  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
     ||||||| ||||| ||||||||||||||||||    
24812932 aagaattttggttt-atccccctgtcatatcat 24812901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 387 - 499
Target Start/End: Original strand, 25601798 - 25601910
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||||||||||  |||   |||||||||| ||||||||||||| ||||| ||||||||| |||||||||||| |    
25601798 ttgtttagattccaaccttgtaatttgaagattttttggcttaaaaccttcatgatatcaaattacaaaatttaatgtactttcgccccctgtaatttta 25601897  T
487 gagaatttcggtt 499  Q
25601898 gagaatttcggtt 25601910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 390 - 611
Target Start/End: Complemental strand, 15635384 - 15635163
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||||||| || |||||||||||| |||| | |||| ||||| ||| ||||||||| |||| |||| |||||||||| ||||| ||| |||||||    
15635384 tttagattccaactctgtaatttgaagatattttgattttgaacctttatgccatcaaatttcaaaatttatggtactttcgccccctataacttgagag 15635285  T
490 aatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtcaatattgatgaagttttaaaacca 588  Q
    |||||| |||| | ||||||  |||||||| |||||||||||| |||||  || ||||||   ||||| ||  || || ||| |||||| |  |||||||    
15635284 aatttc-gttttacccccctaccatatcatcgatatttcggtttaccccatgccatatcatctattttatacggttaaaattcatgaaggtccaaaacca 15635186  T
589 aaaatctttaaattacagcgttg 611  Q
    |||||||| ||||||||| ||||    
15635185 aaaatcttcaaattacagggttg 15635163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 391 - 519
Target Start/End: Original strand, 45687693 - 45687818
391 ttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagaga 490  Q
    ||||||||||||||| ||||||||||||| ||| | ||| |||||||||| |||||||||| ||| ||||||||||||||  ||||| ||||||||||||    
45687693 ttagattccaaccctgtaatttgaagattctttga-tttagaccttcatggcatcaaattataaaatttaaggtactttcaccccctataatttgagaga 45687791  T
491 atttcggtttaatccccctgtcatatcat 519  Q
    |||| ||||||   |||||||||||||||    
45687792 attttggttta--tcccctgtcatatcat 45687818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 27082594 - 27082708
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||||||| || ||| ||||||||| |||   ||| ||| || |||| ||||||||||||| ||||||||||||||| ||||||||||||||    
27082594 ttgtttagattccaacactgtaacttgaagattctttggttttagacatttatgaaatcaaattacaaagtttaaggtactttcgccccctgtaatttga 27082693  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
27082694 gataattttggttta 27082708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 27195707 - 27195593
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||||||| || ||| ||||||||| |||   ||| ||| || |||| ||||||||||||| ||||||||||||||| ||||||||||||||    
27195707 ttgtttagattccaacactgtaacttgaagattctttggttttagacatttatgaaatcaaattacaaagtttaaggtactttcgccccctgtaatttga 27195608  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
27195607 gataattttggttta 27195593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 387 - 483
Target Start/End: Complemental strand, 19377191 - 19377094
387 ttgtttagattccaaccc-tataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatt 483  Q
    |||||||||||||||||| | |||||||||||| |||| | |||||||||||||| | |||||||||||| ||||||||||||||| ||| |||||||    
19377191 ttgtttagattccaacccctgtaatttgaagatatttttattttggaccttcatggcgtcaaattacaaaatttaaggtactttcgccccttgtaatt 19377094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 390 - 501
Target Start/End: Complemental strand, 15012066 - 15011955
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||||| ||| ||||||||||||| ||| | |||| || |||| | |||||||||||||| || |||||| |||  ||| | ||||||||||||    
15012066 tttagattccaatcctgtaatttgaagattctttgattttgaacattcacggcatcaaattacaaaattcaaggtatttttatcctcggtaatttgagag 15011967  T
490 aatttcggttta 501  Q
15011966 aatttcggttta 15011955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 27485060 - 27484945
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    ||||||||||| |||| | ||||||||||||||||||  | |||||| ||||||| ||| |||||| ||| |||||| ||||||   || || |||||||    
27485060 ttgtttagatttcaacgcgataatttgaagattttttttattttggatcttcatggcattaaattaaaaaatttaagatacttttaccctctataatttg 27484961  T
486 agagaatttcggttta 501  Q
    |||||||||| |||||    
27484960 agagaatttcagttta 27484945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 405 - 501
Target Start/End: Original strand, 22859340 - 22859435
405 tataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||||||||   |||||| ||||||| | |||| ||||||| |||| ||||||||||| || |||||||||||  ||||| ||||||    
22859340 tataatttgaagattttttggttttggatcttcatggcttcaagttacaaaatttatggtactttcgt-ccatgtaatttgagcaaattttggttta 22859435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 390 - 501
Target Start/End: Original strand, 22610110 - 22610223
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtc--ccctgtaatttgag 487  Q
    |||||||| |||| ||  |||||||||||| |||| |||||||| || |||| ||||||||| ||| ||||| ||| |||  ||  || |||||||||||    
22610110 tttagatttcaactctgcaatttgaagattatttagctttggacttttatgatatcaaattataaaatttaaagtatttttatcctccttgtaatttgag 22610209  T
488 agaatttcggttta 501  Q
    ||||||| ||||||    
22610210 agaattttggttta 22610223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 439
Target Start/End: Complemental strand, 3092527 - 3092476
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcat 439  Q
    ||||||||||||||||||| ||||||||||||||||  | |||||||||||||    
3092527 ttgtttagattccaaccctgtaatttgaagatttttgta-tttggaccttcat 3092476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 524 - 602
Target Start/End: Complemental strand, 17155771 - 17155693
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaatt 602  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||    
17155771 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatcttcaaatt 17155693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 442 - 487
Target Start/End: Complemental strand, 10975769 - 10975724
442 catcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||| | || |||||||||||||| |||||||||||    
10975769 catcaaattacaaaatctatggtactttcgtcccttgtaatttgag 10975724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 452 - 501
Target Start/End: Original strand, 14675639 - 14675688
452 caaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||| ||||| ||||||| | |||||||||||||||||||||| ||||||    
14675639 caaaatttaaagtacttttgccccctgtaatttgagagaattttggttta 14675688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 96; Significance: 2e-46; HSPs: 19)
Name: chr4

Target: chr4; HSP #1
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 323 - 603
Target Start/End: Complemental strand, 8810242 - 8809963
323 agggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattttt 422  Q
    |||||||||||||||||  |||||||||||||| ||||||| |||| |  |||||         ||||| ||||| ||||| | ||||||||||||||||    
8810242 agggttaatatatgtttatccctgtaatattagcgatttccggtttactccctgtaaaaaaaaattgttaagatttcaaccttgtaatttgaagattttt 8810143  T
423 taactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattga 522  Q
    | | ||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||| ||||||||||||  |||||| |||| |||| ||    
8810142 ttattttggaccttcatgacatcaaattataaaatttaaggtactttcgtcccgtgtaatttgagaaaatttcggttta--ccccctatcatgtcatcga 8810045  T
523 tatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaatta 603  Q
    |||||| ||||  |||| |  |||||| |||||||||| | | || ||| |||||| || ||||| ||||||||| ||||||    
8810044 tatttcaggttaccccctgtcatatcattgattttgtacaattaaaattcatgaaggttcaaaactaaaaatcttcaaatta 8809963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 539
Target Start/End: Original strand, 13555600 - 13555815
323 agggttaatatatgtttgccc-ctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttt 421  Q
    ||||||||||||||||| ||| |||||||||||| ||||||| |||| || |||||         ||| ||||||| ||||||| |||||||||||||||    
13555600 agggttaatatatgtttaccctctgtaatattagcgatttccggtttacc-cctgtaaaaaaaatttggttagatttcaaccctgtaatttgaagatttt 13555698  T
422 tta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||  | ||||||||||||||||||||||||| ||| ||||||||||||| ||||| |||||||||||||||||||||||||  ||||||  ||||||||     
13555699 tttgattttggaccttcatgacatcaaattataaaatttaaggtacttttgtcccttgtaatttgagagaatttcggttta--ccccctaccatatcatc 13555796  T
521 gatatttcggttcaccccc 539  Q
     ||||||||||| ||||||    
13555797 aatatttcggtttaccccc 13555815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 387 - 616
Target Start/End: Complemental strand, 5283900 - 5283672
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||| ||| ||||||||||||||||| | |||| ||||||||| |||||||||| ||| ||||||||||| | | ||| ||||||||||    
5283900 ttgtttagattccaatcctgtaatttgaagattttttgattttgaaccttcatggcatcaaattaaaaaatttaaggtactcttgccccttgtaatttga 5283801  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
      |||||||||||||  |||||||  ||||||| ||||||||| || |||| |  | ||||||  ||||||||| |||||| ||| |||||| || ||||    
5283800 aggaatttcggttta--ccccctgcaatatcatcgatatttcgatttaccctctaccatatcatcgattttgtagagtcaaaattcatgaaggttcaaaa 5283703  T
586 ccaaaaatctttaaattacagcgttgaaatc 616  Q
    ||||||||||| |||||| || |||||||||    
5283702 ccaaaaatcttcaaattaaagtgttgaaatc 5283672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 9780392 - 9780506
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| ||| | ||| ||||| |||| |||||||||| ||| |||||||||||||| |||||||||||||||    
9780392 ttgtttagattccaaccctgtaatttgaagattctttgattttcgacctacatggcatcaaattaaaaaatttaaggtactttcatcccctgtaatttga 9780491  T
487 gagaatttcggttta 501  Q
    || ||||||||||||    
9780492 gataatttcggttta 9780506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 394 - 617
Target Start/End: Complemental strand, 42161509 - 42161286
394 gattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatt 493  Q
    |||||||| ||| |||||||||||| |||||| |||||||||| | | |||||||||||||| |||||||||||||||  || |||||||||||||||||    
42161509 gattccaatcctgtaatttgaagatcttttaattttggaccttgaaggcatcaaattacaaaatttaaggtactttcgctccttgtaatttgagagaatt 42161410  T
494 tcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaa 592  Q
    ||| ||| | || |||| |||||||| |||||||| ||| |||| | |  ||||||   ||||||||    ||| ||| |||||| |  |||| ||||||    
42161409 tcgattt-accctcctgccatatcatcgatatttcagtttaccctctgtcatatcatcaattttgtacctacaaaattcatgaaggtcaaaaatcaaaaa 42161311  T
593 tctttaaattacagcgttgaaatct 617  Q
    |||| ||||||||| ||||||||||    
42161310 tcttcaaattacagagttgaaatct 42161286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 16875937 - 16876051
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | || |||||||||| ||| | ||| |||||| ||| |||||||||||||| ||||||||| ||| ||||||||||||||||    
16875937 ttgtttagattacaaccttgtagtttgaagattctttgattttcgacctttatggcatcaaattacaaaatttaaggtatttttgtcccctgtaatttga 16876036  T
487 gagaatttcggttta 501  Q
16876037 gagaatttcggttta 16876051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 16734350 - 16734215
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | ||||||||||||| ||| | ||| |||||||||| ||| |||||||||| ||||||||| |||||  |||||||||||||    
16734350 ttgtttagatttcaacc-tgtaatttgaagattctttgattttagaccttcatggcataaaattacaaaatttaaggtattttcgcaccctgtaatttga 16734252  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    ||||||||| |||||  || || ||||||||||||||    
16734251 gagaatttcagtttagccctcccgtcatatcattgat 16734215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 387 - 495
Target Start/End: Original strand, 49277727 - 49277835
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | ||||||||| ||| |||   |||||||||||||| |||||||||||||| ||||||||||||| | || ||||||||||     
49277727 ttgtttagattccaaccgtgtaatttgaaaattatttggttttggaccttcatggcatcaaattacaaaatttaaggtacttttgccctctgtaatttgc 49277826  T
487 gagaatttc 495  Q
49277827 gagaatttc 49277835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 323 - 486
Target Start/End: Original strand, 8678824 - 8678989
323 agggttaatatatgtttgcccct--gtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    ||||||||||||||||| |||||  |||||||||  |||||||||||| || |||||         |||||||||||| |||| | ||||||||||||||    
8678824 agggttaatatatgtttacccctatgtaatattatcgatttccagtttaccccctgtaaaaaaaa-ttgtttagattcaaaccttgtaatttgaagattt 8678922  T
421 ttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||  | |||||||||||||| |||||||||||||| ||||||||||||||| | | ||||||||||    
8678923 tttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgcctcttgtaatttga 8678989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 49533332 - 49533218
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||  |||| ||||||||||||||| |||   ||||||||||||||||||||||||||||| ||||| ||| ||| | ||| | ||||||||    
49533332 ttgtttagattataaccttataatttgaagattatttggttttggaccttcatgacatcaaattacaaaatttaacgtatttttgccccttataatttga 49533233  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
49533232 gagaatttcgattta 49533218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 469
Target Start/End: Complemental strand, 25786388 - 25786326
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtacttt 469  Q
    ||||||||||||| ||| | |||| ||||||||| ||||||||||||||||||||||||||||    
25786388 taatttgaagattctttgattttgaaccttcatggcatcaaattacaaattttaaggtacttt 25786326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 388 - 501
Target Start/End: Complemental strand, 21744998 - 21744885
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||| | ||||||||| ||| |||   ||||||  |||||||| | |||||||||| ||| |||| ||||||   | |||||||||||    
21744998 tgtttagattccaaccatgtaatttgaatattctttggttttggattttcatgacgtgaaattacaaaattttaggtgctttcgcttcttgtaatttgag 21744899  T
488 agaatttcggttta 501  Q
21744898 agaatttcggttta 21744885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 524 - 605
Target Start/End: Original strand, 32681909 - 32681990
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   |||||||||  ||||| ||| |||||| |||||||||||||||||||||||||||    
32681909 atttcggtttacccctgctatatcttcgattttgtactgtcaaaattcatgaaggtttaaaaccaaaaatctttaaattaca 32681990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 407 - 501
Target Start/End: Original strand, 29172622 - 29172715
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||| ||||||||| | |||||||||| ||| |||||| || |||| |||||||||| |||||||  ||||||||||| |||||| ||||||    
29172622 taatttggagatttttttattttggaccttaatggcatcaagtttcaaaatttaaggtacgttcgtcca-tgtaatttgagcgaattttggttta 29172715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 387 - 441
Target Start/End: Original strand, 29700563 - 29700617
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||||||||||| | ||||||||||| ||||| ||| |||||||||||    
29700563 ttgtttagattccaaccctgttatttgaagattctttaatttttgaccttcatga 29700617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 439
Target Start/End: Complemental strand, 23091928 - 23091876
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcat 439  Q
    ||||||||||||||||| | ||||||||||||||||||  |||| ||||||||    
23091928 ttgtttagattccaaccttgtaatttgaagattttttagttttgaaccttcat 23091876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 390 - 501
Target Start/End: Original strand, 37589461 - 37589572
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||| ||| |||||||| |||||| ||||  ||||||| | ||| ||||||||||  ||| ||||||||||| |  | || ||||||| ||| |    
37589461 tttagattccgaccatataatttaaagattctttagatttggacatacattacatcaaattttaaaatttaaggtactcttataccatgtaattagagcg 37589560  T
490 aatttcggttta 501  Q
    ||||| ||||||    
37589561 aattttggttta 37589572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 524 - 605
Target Start/End: Original strand, 7913324 - 7913405
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  |||||||||||| || ||||||||    
7913324 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatattcaaattaca 7913405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 524 - 605
Target Start/End: Complemental strand, 21507989 - 21507908
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  |||||||||||| || ||||||||    
21507989 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatattcaaattaca 21507908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 6e-43; HSPs: 18)
Name: chr3

Target: chr3; HSP #1
Raw Score: 90; E-Value: 6e-43
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 7308308 - 7308175
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||| ||||||||||||||||||||||||||||||| | ||| |||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||    
7308308 ttgttcagattccaaccctataatttgaagatttttttatttttgaccttcatggcatcaaattacaaaatttaaggtactttcg-cccctgtaatttga 7308210  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||||||||||||  ||||||| ||||||||||||    
7308209 gagaatttcggttta--ccccctgccatatcattgat 7308175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 538
Target Start/End: Original strand, 55257638 - 55257854
323 agggttaatatatgtttgcccc---tgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatt 419  Q
    ||||||||||||||||| ||||   ||||||||||| ||||||| |||| || |||||         |||||||||||||||||||||||||||||||||    
55257638 agggttaatatatgtttaccccccctgtaatattagcgatttccggtttaccccctgtaaaaaaaa-ttgtttagattccaaccctataatttgaagatt 55257736  T
420 ttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcat 519  Q
    |||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| | |||||||| |||||||| |||| |  |||||| ||||||||    
55257737 tttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttataatttgatagaatttcagttt-acacccctgccatatcat 55257835  T
520 tgatatttcggttcacccc 538  Q
     |||||||| ||| |||||    
55257836 cgatatttcagtttacccc 55257854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 387 - 528
Target Start/End: Complemental strand, 43426505 - 43426365
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| ||||||||||||||||| | ||| |||||||||  |||||||||||||| ||||||||||||| | ||||||||||||||    
43426505 ttgtttagattcgaaccctgtaatttgaagattttttgattttagaccttcatagcatcaaattacaaaatttaaggtacttttgccccctgtaatttga 43426406  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttc 528  Q
    |||||||||||||| | ||||||| |||||||| ||||||||    
43426405 gagaatttcggttt-acccccctgccatatcatcgatatttc 43426365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 387 - 605
Target Start/End: Complemental strand, 17030828 - 17030611
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    |||||| |||| ||||||| |||||| ||||||||||  | |||||||||||||| |||||||||||||| ||||||||||||||  ||||||||| |||    
17030828 ttgttttgatttcaaccctctaatttaaagatttttttgattttggaccttcatggcatcaaattacaaaatttaaggtactttc-acccctgtaaattg 17030730  T
486 agagaatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    ||||||||| ||||||  || |||| |||||||| |||||||| ||||  | || |  |||||| |||||||||| |||||| ||| |||||| |  |||    
17030729 agagaattttggttta--cctcctgccatatcatcgatatttcaggttaccacctgacatatcattgattttgtacagtcaaaattcatgaaggtccaaa 17030632  T
585 accaaaaatctttaaattaca 605  Q
    |||||||||||| ||||||||    
17030631 accaaaaatcttcaaattaca 17030611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 73; E-Value: 8e-33
Query Start/End: Original strand, 427 - 617
Target Start/End: Original strand, 25124872 - 25125061
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatt 526  Q
    |||||||||||||| |||||||||| ||| ||||||||||||||| ||| ||||||||| ||||||||| |||||  ||||||| |||||||| ||||||    
25124872 tttggaccttcatggcatcaaattataaaatttaaggtactttcgccccttgtaatttgggagaatttcagttta--ccccctgccatatcatcgatatt 25124969  T
527 tcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    || ||| ||||||  | ||||||  ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||| || | ||||||||    
25124970 tcagtttacccccttccatatcatcgattttgtacagtcaaaattcatgaaggtcaaaaaccaaaaatcttcaaattatagggatgaaatct 25125061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 387 - 519
Target Start/End: Original strand, 18359295 - 18359424
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| ||||  ||| ||  | |||| |||||||||||||| ||||||||||||| |||| |||||||||||    
18359295 ttgtttagattccaaccctgtaatttgaagattctttagttttagatatacatggcatcaaattacaaaatttaaggtactttagtccgctgtaatttga 18359394  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    ||||||||||| |||   |||||||||||||||    
18359395 gagaatttcggatta---cccctgtcatatcat 18359424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 387 - 502
Target Start/End: Complemental strand, 25159129 - 25159014
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||| | ||||||||| ||||||| | ||||||| |||||| |||||||||||||| ||||||||| ||||| | ||||||||||||    
25159129 ttgtttagattctaaccttgtaatttgaatattttttgattttggacgttcatggcatcaaattacaaaatttaaggtattttcgcctcctgtaatttga 25159030  T
487 gagaatttcggtttaa 502  Q
    |||||||| |||||||    
25159029 gagaattttggtttaa 25159014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 387 - 538
Target Start/End: Complemental strand, 17582613 - 17582462
387 ttgtttagattccaaccctataatttgaagatttttta--actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||| |||| |||| | |||||||||||||||||   | |||||||||||||  |||||||||||||| ||||||||||||||| ||| ||||||||    
17582613 ttgtttaaattcaaaccttgtaatttgaagatttttttttattttggaccttcatagcatcaaattacaaaatttaaggtactttcgccccttgtaattt 17582514  T
485 gagagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc 538  Q
    |||||| ||||||||||  || |||| ||||| || |||||||| ||| |||||    
17582513 gagagattttcggttta--cctcctgccatataatcgatatttcagttaacccc 17582462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 387 - 494
Target Start/End: Original strand, 7013229 - 7013336
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||  |||||||||||||||| ||| | ||||||| ||||||  ||||||||||||| |||||| |||||||| ||| ||||||||||    
7013229 ttgtttagatttcaattctataatttgaagattatttgattttggactttcatggtatcaaattacaaaatttaagatactttcgccccatgtaatttga 7013328  T
487 gagaattt 494  Q
7013329 gagaattt 7013336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 23070058 - 23070172
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||||   |||||| |||||||||| | |||| |||||| ||||||||||||| ||| ||||||||||||||| ||| | ||||||||    
23070058 ttgtttagatttcaacctagtaatttaaagattttttgattttgaaccttcgtgacatcaaattataaaatttaaggtactttcgccccttctaatttga 23070157  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
23070158 gagaatttcgattta 23070172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 45008176 - 45008061
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    |||||||||||| ||| || |||||||||||||||||  | ||||||| ||| || |||||||||||||| ||||||| ||||||| ||| |||||||||    
45008176 ttgtttagattctaactctgtaatttgaagattttttttattttggacattcttggcatcaaattacaaaatttaaggaactttcgccccttgtaatttg 45008077  T
486 agagaatttcggttta 501  Q
    | | ||||||||||||    
45008076 ataaaatttcggttta 45008061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 5303750 - 5303666
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||||||||||||||| ||||||||||||| |||   ||| ||||||||||||||||||||||| |  ||||||||||||||    
5303750 ttgtttagattccaaccctgtaatttgaagattctttggttttagaccttcatgacatcaaattacagaacttaaggtactttcg 5303666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 390 - 519
Target Start/End: Complemental strand, 30226366 - 30226239
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||||| |  | ||||||||||||| ||| | ||||||||||||||||| ||||||||||| |||| |||||||||  ||| |||| ||||||      
30226366 tttagattccatcattgtaatttgaagattctttgattttggaccttcatgacaacaaattacaaaatttatggtactttcaccccttgtagtttgagca 30226267  T
490 aatttcggtttaatccccctgtcatatcat 519  Q
    |||||  |||||  ||||||||||||||||    
30226266 aattttagttta--ccccctgtcatatcat 30226239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 405 - 501
Target Start/End: Complemental strand, 37050262 - 37050166
405 tataatttgaagattttttaactttggaccttcat-gacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||||||||||| ||| | ||||||| ||| | |||||||| ||||||| ||||||||||||||| ||| |||||||||||  ||||||| ||||    
37050262 tataatttgaagattctttgattttggacattctttgacatcaa-ttacaaaatttaaggtactttcgccccttgtaatttgagcaaatttcgattta 37050166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 540 - 611
Target Start/End: Complemental strand, 17582310 - 17582239
540 gctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttg 611  Q
    ||||||||| |||||||||||  |||| ||| |||||| || ||||| ||||||||||||||||||| ||||    
17582310 gctatatcattgattttgtaatttcaaaattcatgaaggttcaaaacgaaaaatctttaaattacagggttg 17582239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 427 - 494
Target Start/End: Complemental strand, 20275600 - 20275533
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaattt 494  Q
    |||||||||| ||||||||||||| |||| ||||||||| ||| | |  ||||||||| |||||||||    
20275600 tttggacctttatgacatcaaatttcaaaatttaaggtatttttgccaactgtaatttaagagaattt 20275533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 320 - 368
Target Start/End: Original strand, 7308039 - 7308088
320 taaagggttaatatatgttt-gcccctgtaatattagtgatttccagttt 368  Q
    ||||||||||||||||||||  |||||||||||||||||| |||| ||||    
7308039 taaagggttaatatatgtttaccccctgtaatattagtgaattccggttt 7308088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 324 - 361
Target Start/End: Original strand, 25158790 - 25158827
324 gggttaatatatgtttgcccctgtaatattagtgattt 361  Q
    |||||||||||||||| ||||||||||||||| |||||    
25158790 gggttaatatatgtttacccctgtaatattagcgattt 25158827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 88; Significance: 9e-42; HSPs: 12)
Name: chr5

Target: chr5; HSP #1
Raw Score: 88; E-Value: 9e-42
Query Start/End: Original strand, 387 - 616
Target Start/End: Complemental strand, 20355314 - 20355086
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||| ||| ||||||||||||||||| | |||| ||||| ||| |||||||||| ||| ||||||||||| | | ||| ||||||||||    
20355314 ttgtttagattccaatcctgtaatttgaagattttttgattttgaaccttgatggcatcaaattaaaaaatttaaggtactcttgccccttgtaatttga 20355215  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
      |||||||||||||  |||||||  ||||||| ||||||| |||| ||||||  | ||||||  ||||||||| |||||| ||| |||||| || ||||    
20355214 aggaatttcggttta--ccccctgcaatatcatcgatattttggtttaccccctaccatatcatcgattttgtacagtcaaaattcatgaaggttcaaaa 20355117  T
586 ccaaaaatctttaaattacagcgttgaaatc 616  Q
    ||||||||||| ||||||||| |||||||||    
20355116 ccaaaaatcttcaaattacagtgttgaaatc 20355086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 42779107 - 42778875
387 ttgtttagattccaaccctataatttgaagattttt-----taactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaa 481  Q
    ||||||||||||||||||| | |||||||  |||||     | | ||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||    
42779107 ttgtttagattccaaccctgttatttgaatttttttattttttattttggaccttcatgacatcaaattacaaaatttaaggtactttcg-cccttgtaa 42779009  T
482 tttgagagaatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttt 580  Q
    ||||||||||||||||||||    |||| ||||||||| |||||||| ||||  |||| || |||||| |||||||||| || ||| ||| |||||| ||    
42779008 tttgagagaatttcggttta---tccctatcatatcatcgatatttcaggttaccccctgccatatcattgattttgtacagccaaaattcatgaaggtt 42778912  T
581 taaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| ||| |||| ||||||||| |||| |||||    
42778911 taaaaccgaaattcttcaaattacagagttggaatct 42778875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 78; E-Value: 8e-36
Query Start/End: Original strand, 387 - 527
Target Start/End: Original strand, 21144023 - 21144161
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||| | ||||||| | ||| ||||||||||    
21144023 ttgtttagattccaaccctgtaatttgaagattttttgattttggaccttcatggcatcaaattacaaaatttgatgtacttttgccccttgtaatttga 21144122  T
487 gagaatttcggtttaatccccctgtcatatcattgatattt 527  Q
    |||||||| ||||||  ||| |||||||||||| |||||||    
21144123 gagaattttggttta--ccctctgtcatatcatcgatattt 21144161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 387 - 523
Target Start/End: Original strand, 13153599 - 13153733
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||||||| || | |||||||||||||  ||||||| |||||| |||| |||||||||||||| ||||||||||    
13153599 ttgtttagattccaaccttgtaatttgaagatttctttattttggaccttcatagcatcaaaatacaaaatttacggtactttcgtcccttgtaatttga 13153698  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||||||||||||  ||||||| ||||| ||||||    
13153699 gagaatttcggttta--ccccctgccatataattgat 13153733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 15399676 - 15399792
387 ttgtttagattccaaccctataatttgaagatttttta--actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    |||||||||| |||||||| |||||||||||||||||   | ||||||||||||| ||||||||||||||| ||||||||||||||| ||| ||||||||    
15399676 ttgtttagatcccaaccctgtaatttgaagatttttttttattttggaccttcataacatcaaattacaaaatttaaggtactttcgccccttgtaattt 15399775  T
485 gagagaatttcggttta 501  Q
    |||| ||||||| ||||    
15399776 gagataatttcgattta 15399792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 539
Target Start/End: Complemental strand, 37869611 - 37869460
387 ttgtttagatt-ccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    ||||||||||| |||||| | ||||||||||||| ||| | |||||||||||||| |||||||||||||| ||||||||||||| | ||| | |||||||    
37869611 ttgtttagatttccaaccttgtaatttgaagattctttgattttggaccttcatgtcatcaaattacaaaatttaaggtacttttgccccttataatttg 37869512  T
486 agagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc 539  Q
    ||||||||||  ||||  || |||| |||||||| |||||||| ||| ||||||    
37869511 agagaatttctattta--cctcctgccatatcatcgatatttcagtttaccccc 37869460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 407 - 501
Target Start/End: Complemental strand, 17668830 - 17668736
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||| |||||| ||| | ||||||| ||||||| |||||| |  ||| ||||||||||||||| |||||||||||||||||||||| ||||||    
17668830 taatttaaagattctttgattttggactttcatgatatcaaaatttaaaatttaaggtactttcgccccctgtaatttgagagaattttggttta 17668736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 407 - 483
Target Start/End: Complemental strand, 31567880 - 31567804
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatt 483  Q
    |||||||||||||||||   ||||||||||||||| ||||||||||||| ||||  ||||||||| | |||||||||    
31567880 taatttgaagattttttggttttggaccttcatgatatcaaattacaaaatttatagtactttcgcctcctgtaatt 31567804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 405 - 443
Target Start/End: Complemental strand, 21125374 - 21125336
405 tataatttgaagattttttaactttggaccttcatgaca 443  Q
    ||||||||||||||||||||  |||||||||||||||||    
21125374 tataatttgaagattttttagttttggaccttcatgaca 21125336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Complemental strand, 21144258 - 21144205
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||||||||| | |||||||||||| |||||  |||||||||||||||    
21144258 ttgtttagattccaaccttgtaatttgaagat-ttttaggtttggaccttcatga 21144205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 31312692 - 31312746
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| | |||||||||||||||| ||||||||    
31312692 gattttgtacagtcaaaattcatgaaggtctaaaaccaaaaatcttcaaattaca 31312746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 551 - 611
Target Start/End: Original strand, 18231998 - 18232059
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaa-aatctttaaattacagcgttg 611  Q
    ||||||||| |||||| ||| |||||| || ||||||||| |||||||||||||||| ||||    
18231998 gattttgtagagtcaaaattcatgaaggttcaaaaccaaagaatctttaaattacagggttg 18232059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 86; Significance: 1e-40; HSPs: 20)
Name: chr1

Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 390 - 605
Target Start/End: Original strand, 25059868 - 25060082
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||  || ||| |||||| || ||||||| | |||||||||||| |||||||||||||||| ||||||||| ||||| ||| |||||||||||||    
25059868 tttagattttaatcctctaatttaaatattttttgattttggaccttcaagacatcaaattacaaaatttaaggtattttcgccccttgtaatttgagag 25059967  T
490 aatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaacca 588  Q
     |||||||||||  |||||||||||||||| |||||||| ||||  |||| || |||||| |||||||||| | |||| ||| |||||| || ||||| |    
25059968 catttcggttta--ccccctgtcatatcatcgatatttcaggttaccccctgccatatcattgattttgtacaatcaaaattcatgaaggttcaaaacta 25060065  T
589 aaaatctttaaattaca 605  Q
    |||||||| ||||||||    
25060066 aaaatcttcaaattaca 25060082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 13437117 - 13436988
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||| |||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||    
13437117 ttgtttagattccaaccgtgtaatttgatgattttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgccccttgtaatttga 13437018  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    |||||||| ||||||   |||||||||||||||    
13437017 gagaattttggttta---cccctgtcatatcat 13436988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 387 - 603
Target Start/End: Complemental strand, 5469592 - 5469375
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||  |||||| | |||||||||||||| ||||||| |||||| ||||||||| ||| | |||||||||| |||    
5469592 ttgtttagattccaaccttgtaatttgaattttttttgattttggaccttcatggcatcaaactacaaaatttaaggtatttttgccccctgtaatatga 5469493  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc--gctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    |||||||||||||| | ||||||   ||||||||||||||||  || | ||||  |||||||||  |||||||||  ||||| ||| |||||| |  |||    
5469492 gagaatttcggttt-acccccctactatatcattgatatttcaatttatccccttgctatatcatcgattttgtatggtcaaaattaatgaagatccaaa 5469394  T
585 accaaaaatctttaaatta 603  Q
    || ||||||||| ||||||    
5469393 actaaaaatcttcaaatta 5469375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 387 - 538
Target Start/End: Original strand, 17890132 - 17890281
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| |||||| |||||||||||  |||||| | ||||  |||||||||||||| |||||||||||| |||||  ||||||||||    
17890132 ttgtttagattccaaccctgtaatttaaagattttttat-tttggatcctcatagcatcaaattacaaaatttaaggtacttccgtccattgtaatttga 17890230  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc 538  Q
    |||||||||||||| | | |  ||||||||||| |||||||| ||| |||||    
17890231 gagaatttcggttt-acctctatgtcatatcatcgatatttcagtttacccc 17890281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 33864321 - 33864207
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| |||   |||||||||| ||| |||||||||||||| ||||||||| ||||| | ||||||||||      
33864321 ttgtttagattccaaccctgtaatttgaagattctttggttttggacctttatggcatcaaattacaaaatttaaggtattttcgcctcctgtaattttc 33864222  T
487 gagaatttcggttta 501  Q
33864221 gagaatttcggttta 33864207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 33916601 - 33916715
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| |||   |||||||||| ||| |||||||||||||| ||||||||| ||||| | ||||||||||      
33916601 ttgtttagattccaaccctgtaatttgaagattctttggttttggacctttatggcatcaaattacaaaatttaaggtattttcgcctcctgtaattttc 33916700  T
487 gagaatttcggttta 501  Q
33916701 gagaatttcggttta 33916715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 44228543 - 44228414
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||  ||||||||||||| |||   ||||||||||| || ||||||||| |||| ||||||||||||||| |||||||||||| |    
44228543 ttgtttagattgcaacccagtaatttgaagattctttgggtttggaccttcgtggcatcaaatttcaaaatttaaggtactttcg-cccctgtaatttaa 44228445  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    |  ||||||||||||  ||||||| ||||||||    
44228444 gcaaatttcggttta--ccccctggcatatcat 44228414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 387 - 487
Target Start/End: Complemental strand, 7261587 - 7261487
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||| ||| |||   |||||||||||||||||||||||| |||| || ||||||||||   ||||||||||||||    
7261587 ttgtttagattccaaccctgtaatttgaacattctttggttttggaccttcatgacatcaaatttcaaaattgaaggtactttgcccccctgtaatttga 7261488  T
487 g 487  Q
7261487 g 7261487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 9240736 - 9240602
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| ||| ||||||||| || |  |||  ||||||||| ||||||||||  || ||||||||||||||||   |||||||||||    
9240736 ttgtttagattcaaaccctgtaacttgaagattcttcagttttaaaccttcatggcatcaaattatgaaatttaaggtactttcgtattctgtaatttga 9240637  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    ||||||||| |||||  ||| || |||||||||||||    
9240636 gagaatttcagttta--ccctctttcatatcattgat 9240602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 322 - 455
Target Start/End: Original strand, 22315143 - 22315278
322 aagggttaatatatgtttgc--ccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatt 419  Q
    |||||||||||||||||| |  |||||||||||||| ||||||  |||| |  |||||         ||||||||||||||||||| |||||||||||||    
22315143 aagggttaatatatgtttactcccctgtaatattagcgatttctggtttactccctgtaaaaaaaaattgtttagattccaaccctgtaatttgaagatt 22315242  T
420 ttttaactttggaccttcatgacatcaaattacaaa 455  Q
    |||| | |||||||||||||| ||||| ||||||||    
22315243 ttttgattttggaccttcatggcatcatattacaaa 22315278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 501
Target Start/End: Original strand, 22151973 - 22152067
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||||||   |||||||||||||||||||||||| |||| |||| ||||||| || || ||||||||| ||  |||||| |||||    
22151973 taatttgaagatttttttgttttggaccttcatgacatcaaattgcaaaatttatggtacttacgcccactgtaatttaagcaaatttcagttta 22152067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 387 - 469
Target Start/End: Complemental strand, 44078798 - 44078716
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtacttt 469  Q
    ||||||||||||||||| | ||||||||||||  |||   ||||||||||| | |||| ||||| |||| |||||||||||||    
44078798 ttgtttagattccaaccttgtaatttgaagatccttttgttttggaccttcctaacataaaatttcaaaatttaaggtacttt 44078716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 407 - 471
Target Start/End: Complemental strand, 5883076 - 5883012
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    |||||| |||||| |||  ||||| |||||||||||||||||||  ||| |||||||||||||||    
5883076 taattttaagattatttggctttgtaccttcatgacatcaaattttaaaatttaaggtactttcg 5883012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 422
Target Start/End: Original strand, 5469355 - 5469390
387 ttgtttagattccaaccctataatttgaagattttt 422  Q
    ||||||||||||||||| ||||||||||||||||||    
5469355 ttgtttagattccaaccttataatttgaagattttt 5469390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 413 - 501
Target Start/End: Original strand, 23652563 - 23652647
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    | |||||||||| |||||||| ||||    
23652563 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg----ccgtaatttgagcgaatttcgattta 23652647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 583 - 617
Target Start/End: Original strand, 1701191 - 1701225
583 aaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    |||||||||||||||||||||||| ||||||||||    
1701191 aaaccaaaaatctttaaattacagggttgaaatct 1701225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 431 - 523
Target Start/End: Original strand, 16639582 - 16639673
431 gaccttcatgacatcaaattacaaattttaaggtactttcgtccc-ctgtaatttgagagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||| ||||  |||||||||||| |||| |||||||||| |||  |||||||||||| ||||| ||||||  |||||| |||||| ||||||    
16639582 gacctttatgatgtcaaattacaaaatttatggtactttcgcccctttgtaatttgagaaaattttggttta--ccccctatcatattattgat 16639673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 23621217 - 23621275
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    
23621217 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg 23621275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 23737996 - 23738054
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    
23737996 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg 23738054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 387 - 436
Target Start/End: Complemental strand, 18426783 - 18426734
387 ttgtttagattccaaccctataatttgaagattttttaactttggacctt 436  Q
    ||||||||||||||| ||| ||||||||||||||||| |  |||||||||    
18426783 ttgtttagattccaatcctgtaatttgaagatttttttatcttggacctt 18426734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 82; Significance: 3e-38; HSPs: 9)
Name: chr6

Target: chr6; HSP #1
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 407 - 539
Target Start/End: Complemental strand, 9662966 - 9662836
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    ||||||||||||||||| | |||| |||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| |||||  |||    
9662966 taatttgaagattttttgattttgaaccttcatgacatcaaattacaaaatttaaggtacttttgccccctgtaatttgagagaatttcagttta--ccc 9662869  T
507 cctgtcatatcattgatatttcggttcaccccc 539  Q
    | ||||||||||||||||||| |||| ||||||    
9662868 cttgtcatatcattgatattttggtttaccccc 9662836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 390 - 501
Target Start/End: Complemental strand, 25167150 - 25167039
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||||||  | ||||||||||||| ||| | |||||| ||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||    
25167150 tttagattccaactgtgtaatttgaagattatttgattttggatcttcatggcatcaaattacaaaatttaaggtactttcgtcccttgtaatttgagag 25167051  T
490 aatttcggttta 501  Q
25167050 aatttcggttta 25167039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 606
Target Start/End: Complemental strand, 9044699 - 9044480
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||||||||| | ||||||||||||| ||| | |||||||||||||| |||||||||| | | |||||| |||||||  | || |||||||||    
9044699 ttgtttaaattccaaccttgtaatttgaagattatttgattttggaccttcatggcatcaaattatataatttaagatactttcacctcccgtaatttga 9044600  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtc-aatattgatgaagttttaaa 584  Q
    |||||||| ||||||  ||||||| |||||||| |||||||| ||| |||||  || ||||||  ||||||||| |||| || ||| |||||| |  |||    
9044599 gagaattttggttta--ccccctgccatatcatcgatatttcagtttaccccttgccatatcatcgattttgtatagtcaaaaattcatgaaggtccaaa 9044502  T
585 accaaaaatctttaaattacag 606  Q
    | ||||| |||| |||||||||    
9044501 atcaaaattcttcaaattacag 9044480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 3816552 - 3816665
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| |||||||| |||||| |||   |||| | ||||||| |||||||||| ||| ||||||||||||||| ||||||||||||||    
3816552 ttgtttagattccaacc-tataatttaaagattctttggttttgaatcttcatggcatcaaattataaaatttaaggtactttcgccccctgtaatttga 3816650  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
3816651 gaaaattttggttta 3816665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 391 - 497
Target Start/End: Complemental strand, 20757700 - 20757595
391 ttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagaga 490  Q
    |||||||||||||||| ||||||||||||||||   ||||| | |||||||||||||||||||||  |||||||||||||| ||| |||||||| |||      
20757700 ttagattccaacccta-aatttgaagattttttggttttggtcgttcatgacatcaaattacaaaacttaaggtactttcgccccttgtaattttagaag 20757602  T
491 atttcgg 497  Q
20757601 atttcgg 20757595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 390 - 470
Target Start/End: Original strand, 33198591 - 33198671
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc 470  Q
    ||||||||||| |||||||||||||||||| |||   ||| ||| |||||| |||||||||||||| ||||||| ||||||    
33198591 tttagattccatccctataatttgaagattctttggttttagacattcatggcatcaaattacaaaatttaaggcactttc 33198671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 494
Target Start/End: Original strand, 334912 - 335019
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc-gtcccctgtaatttg 485  Q
    |||||||||||  |||| | ||||||||||| ||||||  || |||| |||||||||| |||||| ||| ||||| ||||||||  |||| ||||||||     
334912 ttgtttagattttaaccttgtaatttgaaga-tttttagtttaggacattcatgacattaaattataaaatttaaagtactttcattcccttgtaattta 335010  T
486 agagaattt 494  Q
335011 agagaattt 335019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 407 - 487
Target Start/End: Original strand, 6759744 - 6759824
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||| |||| ||||  ||||||  ||||||| |||||||| |||| ||||||||||||||  ||||| |||||||||    
6759744 taatttgatgattctttagttttggattttcatgagatcaaatttcaaaatttaaggtactttcaccccctttaatttgag 6759824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Complemental strand, 33200067 - 33200013
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||| ||||||| ||||||||||||| ||| | |||||||||| ||||    
33200067 ttgtttagattacaaccctgtaatttgaagattctttgattttggacctttatga 33200013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 80; Significance: 5e-37; HSPs: 1)
Name: scaffold0067

Target: scaffold0067; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 321 - 524
Target Start/End: Complemental strand, 26044 - 25844
321 aaagggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    ||||||||||||||||||| ||||  ||||||||| ||||||| |||| || | |||         || |||||||||||||||| |||||||||| |||    
26044 aaagggttaatatatgtttacccccttaatattagcgatttccggtttaccccttgtaaaaaaaa-ttatttagattccaaccct-taatttgaaggttt 25947  T
421 tttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| | | ||||||||||||||     
25946 tttgattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttgagagaatttcggttt-accaccctgtcatatcatc 25848  T
521 gata 524  Q
25847 gata 25844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 76; Significance: 1e-34; HSPs: 1)
Name: scaffold0004

Target: scaffold0004; HSP #1
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 390 - 532
Target Start/End: Complemental strand, 82444 - 82304
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||| ||||||| |||||| |||||| ||| | ||||||||||||||| ||||||||||||| ||||||||||||||| ||| |||||||||||||    
82444 tttagatttcaaccctttaatttaaagattgtttgattttggaccttcatgatatcaaattacaaaatttaaggtactttcgccccatgtaatttgagag 82345  T
490 aatttcggtttaatccccctgtcatatcattgatatttcggtt 532  Q
    ||||||||||||  |||||||  ||||||| ||||||| ||||    
82344 aatttcggttta--ccccctgctatatcatcgatattttggtt 82304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 63; Significance: 8e-27; HSPs: 1)
Name: scaffold0188

Target: scaffold0188; HSP #1
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 484
Target Start/End: Complemental strand, 13384 - 13286
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||||||||||||| | |||||||||||||||||  | ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||    
13384 ttgtttagattccaaccttgtaatttgaagatttttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgccccatgtaattt 13286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142 (Bit Score: 48; Significance: 7e-18; HSPs: 2)
Name: scaffold0142

Target: scaffold0142; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 447 - 617
Target Start/End: Original strand, 34884 - 35054
447 aattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccccgct-ata 545  Q
    ||||| ||| ||||||||||||||  ||| ||||||||||||| |||| ||||| | ||| |||||||||||| |||||||| ||| ||||||  | |||    
34884 aattaaaaaatttaaggtactttctccccatgtaatttgagagtattttggttt-acccctctgtcatatcatagatatttcagtttaccccctatcata 34982  T
546 tcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    |||  ||||||||| |||||| ||| |||||| |   ||||  |||||||| ||||||||| ||||||||||    
34983 tcatcgattttgtatagtcaaaattcatgaaggtccgaaacacaaaatcttcaaattacagggttgaaatct 35054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 451
Target Start/End: Original strand, 34500 - 34564
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaatta 451  Q
    ||||||| ||||||||| | |||||| |||||||||| |  ||||||||||||| ||||||||||    
34500 ttgtttaaattccaaccttgtaattttaagattttttgatcttggaccttcatggcatcaaatta 34564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 46; Significance: 1e-16; HSPs: 1)
Name: scaffold0110

Target: scaffold0110; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 408 - 501
Target Start/End: Original strand, 23194 - 23287
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||| ||||| | ||| |||||||||| |||||||||||||| ||||| ||| || || || || |||||||||||||||||||||||    
23194 aatttgaagactttttgattttagaccttcatggcatcaaattacaaaatttaacgtatttccgccctctataatttgagagaatttcggttta 23287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0003

Target: scaffold0003; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 407 - 487
Target Start/End: Complemental strand, 306757 - 306678
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    ||||||||||||| |||   |||||||||||||| |||||||||||||| |||| |||||||||| |||||||||||||||    
306757 taatttgaagattctttggttttggaccttcatggcatcaaattacaaaatttatggtactttcg-cccctgtaatttgag 306678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 389 - 501
Target Start/End: Complemental strand, 316699 - 316587
389 gtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgaga 488  Q
    ||||||||||||||||| |||| ||||  |||||| | ||| || |||||||||||||||||   || ||||| ||| ||| |||  ||||||||||||     
316699 gtttagattccaaccctctaatatgaaatttttttgattttagatcttcatgacatcaaattttgaaatttaaagtatttttgtcttctgtaatttgagt 316600  T
489 gaatttcggttta 501  Q
     |||||| |||||    
316599 aaatttcagttta 316587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 44238 times since January 2019
Visitors: 551