View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398-Insertion-2 (Length: 1041)

Name: NF4398-Insertion-2
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398-Insertion-2
NF4398-Insertion-2
[»] chr8 (21 HSPs)
chr8 (8-965)||(23288558-23289528)
chr8 (689-990)||(23390551-23390858)
chr8 (387-617)||(9235357-9235587)
chr8 (8-140)||(23390166-23390301)
chr8 (407-519)||(24375774-24375883)
chr8 (387-501)||(28786366-28786480)
chr8 (145-248)||(23390340-23390442)
chr8 (399-501)||(23245677-23245779)
chr8 (387-617)||(5600186-5600413)
chr8 (387-617)||(5640207-5640434)
chr8 (390-487)||(11908468-11908565)
chr8 (414-605)||(24528821-24529011)
chr8 (387-498)||(13373240-13373351)
chr8 (431-605)||(14698115-14698287)
chr8 (407-466)||(8980741-8980800)
chr8 (325-441)||(13980022-13980135)
chr8 (245-282)||(23390509-23390546)
chr8 (427-487)||(12719189-12719249)
chr8 (551-605)||(9305645-9305699)
chr8 (551-605)||(34227409-34227463)
chr8 (552-605)||(31974930-31974983)
[»] chr2 (17 HSPs)
chr2 (387-617)||(42223095-42223325)
chr2 (387-501)||(11915174-11915288)
chr2 (387-611)||(41906067-41906289)
chr2 (387-519)||(35791134-35791264)
chr2 (387-501)||(11478052-11478166)
chr2 (387-501)||(16590603-16590716)
chr2 (407-501)||(31989508-31989602)
chr2 (407-519)||(31377688-31377798)
chr2 (387-487)||(31397428-31397528)
chr2 (413-484)||(29878811-29878882)
chr2 (387-487)||(41567315-41567415)
chr2 (441-519)||(13315985-13316060)
chr2 (442-501)||(23381344-23381403)
chr2 (324-363)||(42223029-42223068)
chr2 (387-441)||(16590512-16590566)
chr2 (551-605)||(18756588-18756642)
chr2 (408-470)||(24486596-24486658)
[»] chr7 (22 HSPs)
chr7 (322-606)||(1853183-1853463)
chr7 (387-606)||(42957424-42957643)
chr7 (323-539)||(9689223-9689438)
chr7 (388-519)||(2936188-2936316)
chr7 (388-611)||(43393784-43394007)
chr7 (387-617)||(3092292-3092521)
chr7 (427-538)||(11625113-11625222)
chr7 (387-519)||(24812901-24813032)
chr7 (387-499)||(25601798-25601910)
chr7 (390-611)||(15635163-15635384)
chr7 (391-519)||(45687693-45687818)
chr7 (387-501)||(27082594-27082708)
chr7 (387-501)||(27195593-27195707)
chr7 (387-483)||(19377094-19377191)
chr7 (390-501)||(15011955-15012066)
chr7 (387-501)||(27484945-27485060)
chr7 (405-501)||(22859340-22859435)
chr7 (390-501)||(22610110-22610223)
chr7 (387-439)||(3092476-3092527)
chr7 (524-602)||(17155693-17155771)
chr7 (442-487)||(10975724-10975769)
chr7 (452-501)||(14675639-14675688)
[»] chr4 (19 HSPs)
chr4 (323-603)||(8809963-8810242)
chr4 (323-539)||(13555600-13555815)
chr4 (387-616)||(5283672-5283900)
chr4 (387-501)||(9780392-9780506)
chr4 (394-617)||(42161286-42161509)
chr4 (387-501)||(16875937-16876051)
chr4 (387-523)||(16734215-16734350)
chr4 (387-495)||(49277727-49277835)
chr4 (323-486)||(8678824-8678989)
chr4 (387-501)||(49533218-49533332)
chr4 (407-469)||(25786326-25786388)
chr4 (388-501)||(21744885-21744998)
chr4 (524-605)||(32681909-32681990)
chr4 (407-501)||(29172622-29172715)
chr4 (387-441)||(29700563-29700617)
chr4 (387-439)||(23091876-23091928)
chr4 (390-501)||(37589461-37589572)
chr4 (524-605)||(7913324-7913405)
chr4 (524-605)||(21507908-21507989)
[»] chr3 (18 HSPs)
chr3 (387-523)||(7308175-7308308)
chr3 (323-538)||(55257638-55257854)
chr3 (387-528)||(43426365-43426505)
chr3 (387-605)||(17030611-17030828)
chr3 (427-617)||(25124872-25125061)
chr3 (387-519)||(18359295-18359424)
chr3 (387-502)||(25159014-25159129)
chr3 (387-538)||(17582462-17582613)
chr3 (387-494)||(7013229-7013336)
chr3 (387-501)||(23070058-23070172)
chr3 (387-501)||(45008061-45008176)
chr3 (387-471)||(5303666-5303750)
chr3 (390-519)||(30226239-30226366)
chr3 (405-501)||(37050166-37050262)
chr3 (540-611)||(17582239-17582310)
chr3 (427-494)||(20275533-20275600)
chr3 (320-368)||(7308039-7308088)
chr3 (324-361)||(25158790-25158827)
[»] chr5 (12 HSPs)
chr5 (387-616)||(20355086-20355314)
chr5 (387-617)||(42778875-42779107)
chr5 (387-527)||(21144023-21144161)
chr5 (387-523)||(13153599-13153733)
chr5 (387-501)||(15399676-15399792)
chr5 (387-539)||(37869460-37869611)
chr5 (407-501)||(17668736-17668830)
chr5 (407-483)||(31567804-31567880)
chr5 (405-443)||(21125336-21125374)
chr5 (387-441)||(21144205-21144258)
chr5 (551-605)||(31312692-31312746)
chr5 (551-611)||(18231998-18232059)
[»] chr1 (20 HSPs)
chr1 (390-605)||(25059868-25060082)
chr1 (387-519)||(13436988-13437117)
chr1 (387-603)||(5469375-5469592)
chr1 (387-538)||(17890132-17890281)
chr1 (387-501)||(33864207-33864321)
chr1 (387-501)||(33916601-33916715)
chr1 (387-519)||(44228414-44228543)
chr1 (387-487)||(7261487-7261587)
chr1 (387-523)||(9240602-9240736)
chr1 (322-455)||(22315143-22315278)
chr1 (407-501)||(22151973-22152067)
chr1 (387-469)||(44078716-44078798)
chr1 (407-471)||(5883012-5883076)
chr1 (387-422)||(5469355-5469390)
chr1 (413-501)||(23652563-23652647)
chr1 (583-617)||(1701191-1701225)
chr1 (431-523)||(16639582-16639673)
chr1 (413-471)||(23621217-23621275)
chr1 (413-471)||(23737996-23738054)
chr1 (387-436)||(18426734-18426783)
[»] chr6 (9 HSPs)
chr6 (407-539)||(9662836-9662966)
chr6 (390-501)||(25167039-25167150)
chr6 (387-606)||(9044480-9044699)
chr6 (387-501)||(3816552-3816665)
chr6 (391-497)||(20757595-20757700)
chr6 (390-470)||(33198591-33198671)
chr6 (387-494)||(334912-335019)
chr6 (407-487)||(6759744-6759824)
chr6 (387-441)||(33200013-33200067)
[»] scaffold0067 (1 HSPs)
scaffold0067 (321-524)||(25844-26044)
[»] scaffold0004 (1 HSPs)
scaffold0004 (390-532)||(82304-82444)
[»] scaffold0188 (1 HSPs)
scaffold0188 (387-484)||(13286-13384)
[»] scaffold0142 (2 HSPs)
scaffold0142 (447-617)||(34884-35054)
scaffold0142 (387-451)||(34500-34564)
[»] scaffold0110 (1 HSPs)
scaffold0110 (408-501)||(23194-23287)
[»] scaffold0003 (2 HSPs)
scaffold0003 (407-487)||(306678-306757)
scaffold0003 (389-501)||(316587-316699)


Alignment Details
Target: chr8 (Bit Score: 668; Significance: 0; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 668; E-Value: 0
Query Start/End: Original strand, 8 - 965
Target Start/End: Complemental strand, 23289528 - 23288558
Alignment:
8 ataaataggttggaaaagtgtcaaatcctgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 107  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23289528 ataaataggttggaaaagtatcaaatcttgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 23289429  T
108 ctacaaagaaattaatatgacaaatcgatcatcatttatttatactgttagagactataatatgataaacatgtcacatataatattgatcccacatcaa 207  Q
    |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| ||||    
23289428 ctacaaagaaagcaatatgacaaatcgatcatcatttatttatactgttagagactataatattataaacatgtcacatttaatattgatcacacgtcaa 23289329  T
208 tacaatcatctaatccatttgggttggtttggtggagttgtagatgactacatattgcgtcataaactcgaacctaaaagctaacatacggatcatttgg 307  Q
    |||||||||||||  ||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
23289328 tacaatcatctaactcatttggattggtatggtggtgttgtagatgactacatattgcgtcataaactcgaacctaaaagctagcatacggatcatttgg 23289229  T
308 actcataagagttaaagggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctat 407  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||  | |||||         ||||||||||||||||||| |    
23289228 actcataagagttaaagggttaatatatgtttgcccctgtaatattagtgattttcggtttatcccctgt-aaaaaaaattgtttagattccaaccctgt 23289130  T
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaat-ccc 506  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||    
23289129 aatttgaagattttttaactttggaccttcatggcatcaaattacaaaatttaaggtactttcgtcccctgtaatttgagagaatttctgtttaatcccc 23289030  T
507 cctgtcatatcattgatatttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacag 606  Q
    ||||||||||||| ||||||||||||||||| |||||||||| ||||||||||  ||||||||| |||||||| |||||||||||||||| |||||||||    
23289029 cctgtcatatcatcgatatttcggttcaccctcgctatatcattgattttgtacggtcaatattcatgaagttctaaaaccaaaaatcttcaaattacag 23288930  T
607 cgttgaaatct---nnnnnnnnnttacaatggataaatcgaaaatctctaatattac-agggtaaaca-----taacccagagttaaatgtaccaacttg 697  Q
      |||||||||            |||||||||||||| || |||||||||||||||| || |||||||     |||||||||||||||||||||||||||    
23288929 gattgaaatctaaaaaaaaaaaattacaatggataaaccggaaatctctaatattacaagagtaaacatatattaacccagagttaaatgtaccaacttg 23288830  T
698 cctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaatgtcatttc 797  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
23288829 cctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccggcgctgacttcttaaatgtcatttc 23288730  T
798 tatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaattctaatccag 897  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23288729 tatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaattctaatccag 23288630  T
898 gt-cactctctttcttctata--cagaaacaacacatttgcacca-cttgtctatctacttgagtacggaaa 965  Q
    || |||||||| |||||||||   ||||||| ||||||||||||| ||||||| ||||||||||||| ||||    
23288629 gtccactctctgtcttctataacaagaaacagcacatttgcaccaccttgtctgtctacttgagtacagaaa 23288558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 225; E-Value: 1e-123
Query Start/End: Original strand, 689 - 990
Target Start/End: Original strand, 23390551 - 23390858
Alignment:
689 accaacttgcctattcggtcaaaaaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaa 788  Q
    ||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23390551 accaacttgcctattcaatcaataaatttggacgcaacttggctttccctttctttgtaatgtggttgagattgaaaaagaccgacgctgacttcttaaa 23390650  T
789 tgtcatttctatttaatatggtctctaactaggtaaggaaaatttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaatt 888  Q
    |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23390651 tgtcatttctatttaatatggtctctaactgggtaaggaaattttggtcacagcaataaatgattcaataatttgaacctatcacattattgtttcaatt 23390750  T
889 ctaatccaggt-cactctctttcttctata--cagaaacaacacatttgcacca-cttgtctatctacttgagtac-ggaaagtagctaggaa-taaaat 982  Q
    ||||||||||| ||||||||||||||||||   ||||||| ||||||||||||| ||||||||||||||||||||| | ||||| |||| ||| ||||||    
23390751 ctaatccaggtccactctctttcttctataacaagaaacagcacatttgcaccaccttgtctatctacttgagtacagaaaagttgctacgaattaaaat 23390850  T
983 ataaaaaa 990  Q
    ||||||||    
23390851 ataaaaaa 23390858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 6e-46
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 9235587 - 9235357
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| ||||||||||    
9235587 ttgtttagatttcaaccctgtaatttgaagattttttgattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttga 9235488  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcac--ccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
     ||||||| |||||||  ||| || |||||||| |||||||||||| ||  ||| |  ||||||  ||||||||| |||||| ||| |||||| |  |||    
9235487 aagaattttggtttaa--cccttgacatatcatcgatatttcggtttaccaccctgtcatatcatcgattttgtacagtcaaaattcatgaaggtccaaa 9235390  T
585 accaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| |||| ||||||||  ||||||||||    
9235389 accaaaattcttcaaattacatggttgaaatct 9235357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 8 - 140
Target Start/End: Original strand, 23390166 - 23390301
Alignment:
8 ataaataggttggaaaagtgtcaaatcctgctgcaaatatagtcaatgatggcttatggaaacggactagaaccatccctctaactcatgcattttcttt 107  Q
    |||| |||||||||||||||||||||| |||  ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||    
23390166 ataagtaggttggaaaagtgtcaaatcttgcatcaaatatagtcaatgatggcttatggaaacggactagaaccatccctataactcatgcattttcatt 23390265  T
108 ctaca---aagaaattaatatgacaaatcgatcatc 140  Q
    |||||   ||||||||||||||||||||| ||||||    
23390266 ctacaaagaagaaattaatatgacaaatcaatcatc 23390301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 407 - 519
Target Start/End: Original strand, 24375774 - 24375883
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    |||||||||||||||||   |||||||||||||| |||||||||||||| |||| |||||||||||||| |||||||||||  |||||| |||||  |||    
24375774 taatttgaagattttttgt-tttggaccttcatggcatcaaattacaaaatttatggtactttcgtcccttgtaatttgagcaaatttcagttta--ccc 24375870  T
507 cctgtcatatcat 519  Q
    |||| ||||||||    
24375871 cctgccatatcat 24375883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 28786366 - 28786480
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||| | ||||||| ||| | |||||||||||||| |||||| || |||| |||||||||||| ||  |||||||||||||    
28786366 ttgtttagattccaaccctgtaactagaagattatttgattttggaccttcatggcatcaattttcaaactttaaggtacttccgctccctgtaatttga 28786465  T
487 gagaatttcggttta 501  Q
    |  ||||| ||||||    
28786466 gcaaattttggttta 28786480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 145 - 248
Target Start/End: Original strand, 23390340 - 23390442
Alignment:
145 atttatactgttagagactataatatgataaacatgtcacatataatattgatcccacatcaatacaatcatctaatccatttgggttggtttggtggag 244  Q
    |||||||| ||||||| ||| ||||||| ||||||||||||| ||| ||| ||||||||||| | | ||||| |||||||||||||||||| |||||| |    
23390340 atttatacggttagaggctacaatatgacaaacatgtcacatttaacatttatcccacatcagt-ccatcatgtaatccatttgggttggtctggtggtg 23390438  T
245 ttgt 248  Q
    ||||    
23390439 ttgt 23390442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 399 - 501
Target Start/End: Complemental strand, 23245779 - 23245677
Alignment:
399 caaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggt 498  Q
    ||||||| ||||||||||||||||| | |||||||||  ||| ||| |||||  ||| ||||||||||||||| ||| |||||||||||| ||||||| |    
23245779 caaccctgtaatttgaagattttttgattttggacctatatggcattaaattttaaaatttaaggtactttcgccccatgtaatttgagataatttcgtt 23245680  T
499 tta 501  Q
    |||    
23245679 tta 23245677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 5600413 - 5600186
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||  | ||||||| |||||| ||||||| || |||||||||||| ||||| |||||| |    
5600413 ttgtttaaatttcaaccttgtaatttgaagatttttttattttaaatcttcatggcatcaagttacaaaattgaaggtactttcg-cccctataatttta 5600315  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||||||   | ||||||||  |||||||||||| ||| ||| |||| | || |||| |  ||||||||| |||||| ||| || ||| |  ||||    
5600314 gagaatttcgg---attccccctgctatatcattgatagttcagtttaccctctgccatattatcgattttgtacagtcaaaattcataaaggtacaaaa 5600218  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
    | |||||  ||||||||| |  ||||||||||    
5600217 ctaaaaaattttaaattatacggttgaaatct 5600186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 387 - 617
Target Start/End: Original strand, 5640207 - 5640434
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||  | ||||||| |||||| ||||||| || |||||||||||| ||||| |||||| |    
5640207 ttgtttaaatttcaaccttgtaatttgaagatttttttattttaaatcttcatggcatcaagttacaaaattgaaggtactttcg-cccctataatttta 5640305  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||||||   | ||||||||  |||||||||||| ||| ||| |||| | || |||| |  ||||||||| |||||| ||| || ||| |  ||||    
5640306 gagaatttcgg---attccccctgctatatcattgatagttcagtttaccctctgccatattatcgattttgtacagtcaaaattcataaaggtacaaaa 5640402  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
    | |||||  ||||||||| |  ||||||||||    
5640403 ctaaaaaattttaaattatacggttgaaatct 5640434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 390 - 487
Target Start/End: Original strand, 11908468 - 11908565
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||| | ||||||||||||| | |   || ||||||||||| ||||||||| |||| ||||||||||||| |||| ||||||||||||    
11908468 tttagattccaaccatgtaatttgaagattctatggtttaggaccttcatggcatcaaatttcaaaatttaaggtacttttgtcctctgtaatttgag 11908565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 414 - 605
Target Start/End: Complemental strand, 24529011 - 24528821
Alignment:
414 aagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtca 513  Q
    |||||||||| | |||| |||||| || |||||||||| ||| ||||| ||| ||||| ||  |||||||| ||||||| ||||||||  ||||||  ||    
24529011 aagatttttttattttgtaccttcgtggcatcaaattataaaatttaaagtattttcgccctttgtaattttagagaatctcggttta--ccccctacca 24528914  T
514 tatcattgatatttcggttcacccccgcta-tatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||||| |||||||| ||| ||||||  || |||||  ||||||||| |||||| ||| |||||  | ||||||||||||  || ||||||||    
24528913 tatcatcgatatttcagtttaccccctgtaatatcatcgattttgtacagtcaaaattcatgaaaatctaaaaccaaaaagattcaaattaca 24528821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 387 - 498
Target Start/End: Original strand, 13373240 - 13373351
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| |||| || ||||||||||||| |||   |||| |||||| || |||||||||||||| ||||||||| ||| | ||| ||||||||||    
13373240 ttgtttatatttcaactctgtaatttgaagattctttggttttgaaccttcctggcatcaaattacaaaatttaaggtatttttgccccttgtaatttga 13373339  T
487 gagaatttcggt 498  Q
    ||||||| ||||    
13373340 gagaattccggt 13373351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 431 - 605
Target Start/End: Complemental strand, 14698287 - 14698115
Alignment:
431 gaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatttc-g 529  Q
    |||||||||| |||||| ||| ||| ||||||||||||| ||||  |||||||||||| |||||| ||||   ||||||| |||||||| |||||||| |    
14698287 gaccttcatggcatcaa-ttataaaatttaaggtacttttgtcctttgtaatttgagaaaatttcagttt--gccccctgccatatcatcgatatttcag 14698191  T
530 gttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||  |||  || |||||| ||||||||||  ||||| ||| || ||| || ||||  ||||||||| ||||||||    
14698190 gttaccccttgccatatcattgattttgtactgtcaaaattcataaaggttcaaaataaaaaatcttcaaattaca 14698115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 8980800 - 8980741
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtac 466  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||| |||| |||||    
8980800 taatttgaagattctttagttttggaccttcatgacatcaaattacaaaatttatggtac 8980741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 325 - 441
Target Start/End: Complemental strand, 13980135 - 13980022
Alignment:
325 ggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttttta 424  Q
    ||||||||||||||| ||||||||||||||||||||||| |||| || |   |         |||||||||||| |||||| ||||||||||||| |||     
13980135 ggttaatatatgtttacccctgtaatattagtgatttccggtttacccc---ttaaaaaaaattgtttagattctaaccctgtaatttgaagattctttg 13980039  T
425 actttggaccttcatga 441  Q
    | |||||||||||||||    
13980038 attttggaccttcatga 13980022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 245 - 282
Target Start/End: Original strand, 23390509 - 23390546
Alignment:
245 ttgtagatgactacatattgcgtcataaactcgaacct 282  Q
    ||||||||||||||||||||||||||||||||||||||    
23390509 ttgtagatgactacatattgcgtcataaactcgaacct 23390546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 427 - 487
Target Start/End: Original strand, 12719189 - 12719249
Alignment:
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||||||||||| |||| || | | |||||||| ||| |||||||||||    
12719189 tttggaccttcatgacatcaaatttcaaaattgatgatactttcgccccttgtaatttgag 12719249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 9305645 - 9305699
Alignment:
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| || ||||||||||||||| ||||||||    
9305645 gattttgtacagtcaaaattcatgaaggttcaaaaccaaaaatcttcaaattaca 9305699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Complemental strand, 34227463 - 34227409
Alignment:
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| | |||||||||||||||| ||||||||    
34227463 gattttgtacagtcaaaattcatgaaggtctaaaaccaaaaatcttcaaattaca 34227409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 552 - 605
Target Start/End: Original strand, 31974930 - 31974983
Alignment:
552 attttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    |||||||| |||||| ||| |||||| || |||||||||||||||| |||||||    
31974930 attttgtacagtcaaaattcatgaaggttcaaaaccaaaaatctttgaattaca 31974983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 103; Significance: 1e-50; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 1e-50
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 42223325 - 42223095
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||||||| | |||| ||||||||| |||||||||||||| ||||||||||||||| ||| ||||||||||    
42223325 ttgtttagattccaaccctgtaatttgaagattttttgattttgaaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttga 42223226  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcac--ccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
     ||||||||||||||  ||||||| ||||||||  ||||||||||| ||  |||  | ||||||  ||||||||| |||||| ||| |||||| |  |||    
42223225 aagaatttcggttta--ccccctgacatatcatcaatatttcggtttaccaccctaccatatcatcgattttgtacagtcaaaattcatgaagatccaaa 42223128  T
585 accaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| |||| ||||||||| ||||||||||    
42223127 accaaaattcttcaaattacagggttgaaatct 42223095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 11915288 - 11915174
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| |||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||| ||||||| ||| ||||||||||    
11915288 ttgtttaaatttcaactctataatttgaagattttttggttttggaccttcatgacatcaaattacaaaatttaaggcactttcgccccgtgtaatttga 11915189  T
487 gagaatttcggttta 501  Q
    |||||||| ||||||    
11915188 gagaattttggttta 11915174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 611
Target Start/End: Complemental strand, 41906289 - 41906067
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||||| | ||||||||||||||||| | |||||||||| ||| |||||||||||||| ||| |||||||||||  || |||||  |||    
41906289 ttgtttaaatttcaaccttgtaatttgaagatttttttattttggacctttatggcatcaaattacaaaattttaggtactttcg-accttgtaacatga 41906191  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    ||||||||| |||||  ||||||| ||||||||||||||||| ||| ||||||  | |||||   ||||||||| |||||| ||| |||||| |  ||||    
41906190 gagaatttcagttta--ccccctgccatatcattgatatttcagtttacccccttccatatcgtcgattttgtacagtcaaaattcatgaaggtcgaaaa 41906093  T
586 ccaaaaatctttaaattacagcgttg 611  Q
    ||||| ||||| ||||||||| ||||    
41906092 ccaaatatcttcaaattacagggttg 41906067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 35791264 - 35791134
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||| || |||||| |||||| ||| | |||  ||||||||| |||||||||||||| ||||||||||||||| ||  ||||||||||    
35791264 ttgtttagatttcaactctgtaatttaaagattctttgattttaaaccttcatgccatcaaattacaaaatttaaggtactttcgccctttgtaatttga 35791165  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    ||| |||||||||||  ||||||| ||||||||    
35791164 gagtatttcggttta--ccccctgccatatcat 35791134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 11478052 - 11478166
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||| ||| |||   |||||||||||||  |||||||||||||| ||||||||||||||| | | |||||||||     
11478052 ttgtttagatttcaaccctgtaatttgaaaattctttggttttggaccttcatagcatcaaattacaaaatttaaggtactttcgcctcttgtaatttgg 11478151  T
487 gagaatttcggttta 501  Q
    || ||||||||||||    
11478152 gataatttcggttta 11478166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 16590716 - 16590603
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||| ||| ||| ||||||||||||| |||   ||||||||||||||||||||||||||||| ||||||||||||||| | ||| | ||||||    
16590716 ttgtttatatttcaaacctgtaatttgaagattatttggttttggaccttcatgacatcaaattacaaaatttaaggtactttcgcctcctat-atttga 16590618  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
16590617 gagaatttcgattta 16590603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 501
Target Start/End: Complemental strand, 31989602 - 31989508
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||||||||| |||   |||||||||||||| |||||||||||||| |||| |||||||||| ||||| |||| ||||  |||||| |||||    
31989602 taatttgaagattctttggttttggaccttcatggcatcaaattacaaaatttatggtactttcgccccctataatatgagcaaatttcagttta 31989508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 407 - 519
Target Start/End: Complemental strand, 31377798 - 31377688
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    ||||||||||||| |||   |||||||||||||| ||||| |||||||| ||||  ||||||||| | |||||||||||||  ||||| |||||||  ||    
31377798 taatttgaagattatttggttttggaccttcatggcatcatattacaaaatttatagtactttcgcctcctgtaatttgagcaaattttggtttaa--cc 31377701  T
507 cctgtcatatcat 519  Q
    |||| ||||||||    
31377700 cctgccatatcat 31377688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 387 - 487
Target Start/End: Complemental strand, 31397528 - 31397428
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||  || ||| ||||||||||||| |||   |||||||||||||||| ||||||| |||| |||| | |||||||| ||| ||||||||||    
31397528 ttgtttagattgtaaacctgtaatttgaagattatttggttttggaccttcatgacgtcaaatttcaaaatttatgatactttcgccccttgtaatttga 31397429  T
487 g 487  Q
    |    
31397428 g 31397428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 413 - 484
Target Start/End: Original strand, 29878811 - 29878882
Alignment:
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||| ||| | ||||||| |||||| |||||||||||||| |||| |||| ||||||||| ||||||||    
29878811 gaagattctttgattttggacattcatggcatcaaattacaaaatttatggtattttcgtcccttgtaattt 29878882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 487
Target Start/End: Original strand, 41567315 - 41567415
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | ||||||||| ||| ||  | |||||| ||| |||  |||||||| |||| ||||||||||||||| | | ||||||||||    
41567315 ttgtttagatttcaaccttgtaatttgaaaattattcgattttggatctttatggtatcaaatttcaaaatttaaggtactttcgcctcatgtaatttga 41567414  T
487 g 487  Q
    |    
41567415 g 41567415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 441 - 519
Target Start/End: Complemental strand, 13316060 - 13315985
Alignment:
441 acatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcat 519  Q
    |||| |||||||||| ||| ||||||||||| ||| |||||||||| ||||||||| ||||  ||||||| ||||||||    
13316060 acattaaattacaaaatttcaggtactttcg-cccatgtaatttgaaagaatttcgattta--ccccctgccatatcat 13315985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 442 - 501
Target Start/End: Complemental strand, 23381403 - 23381344
Alignment:
442 catcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||| |||| |||||||||| ||| |||||||||||  ||||||| ||||    
23381403 catcaaattacaaaatttatggtactttcgccccttgtaatttgagtaaatttcgattta 23381344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 324 - 363
Target Start/End: Original strand, 42223029 - 42223068
Alignment:
324 gggttaatatatgtttgcccctgtaatattagtgatttcc 363  Q
    |||||||||||||||| ||||| |||||||||||||||||    
42223029 gggttaatatatgtttacccctataatattagtgatttcc 42223068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Original strand, 16590512 - 16590566
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    |||||||||||||||| || |||||||||||||||||   |||| ||||||||||    
16590512 ttgtttagattccaactctgtaatttgaagattttttggttttgcaccttcatga 16590566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 18756588 - 18756642
Alignment:
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| |  ||||||||||||||||||||||||    
18756588 gattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatctttaaattaca 18756642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 408 - 470
Target Start/End: Original strand, 24486596 - 24486658
Alignment:
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc 470  Q
    |||||||| ||| ||||  ||||||| |||||||||||||||| |||| |||||| |||||||    
24486596 aatttgaaaattgtttagttttggactttcatgacatcaaatttcaaaatttaagatactttc 24486658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 96; Significance: 2e-46; HSPs: 22)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 322 - 606
Target Start/End: Complemental strand, 1853463 - 1853183
Alignment:
322 aagggttaatatatgtttgcccc-tgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    |||||||||||||||||| |||| |||||||||||||||||   |||| |||| |||         ||||||||||||||||| | ||||||||||||||    
1853463 aagggttaatatatgtttaccccctgtaatattagtgatttttggtttacctcatgtaaaaaaat-ttgtttagattccaaccttgtaatttgaagattt 1853365  T
421 tttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||| | |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |||||||||||||||||  |||  ||||||| | ||||||     
1853364 tttgattttggaccttcatggcatcaaatttcaaaatttaaggtactttcgtcccctgaaatttgagagaatttcg--tta--ccccctgccttatcatc 1853269  T
521 gatatttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacag 606  Q
    ||||||||| ||  |||| |  ||||||  ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||||||    
1853268 gatatttcgtttaccccctgtcatatcatcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatcttcaaattacag 1853183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 387 - 606
Target Start/End: Original strand, 42957424 - 42957643
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| |||||||||  |||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||    
42957424 ttgtttagattctaaccctgtaatttgaattttttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgtcccttgtaatttga 42957523  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttc--ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    |||||||||| ||||  ||| |||||||||| | ||||||||  | | | |||| ||||||||| |||||||||| | ||||  || |||||| |  |||    
42957524 gagaatttcgattta--ccctctgtcatatcctcgatatttcatgttactcccctgctatatcattgattttgtacaatcaaagttcatgaaggtcgaaa 42957621  T
585 accaaaaatctttaaattacag 606  Q
    |||||||||||| |||||||||    
42957622 accaaaaatcttcaaattacag 42957643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 539
Target Start/End: Original strand, 9689223 - 9689438
Alignment:
323 agggttaatatatgtttgccc-ctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttt 421  Q
    ||||||||||||||||| ||| |||||||||||| ||||||| |||| || |||||         ||| ||||||| ||||||| |||||||||||||||    
9689223 agggttaatatatgtttaccctctgtaatattagcgatttccggtttacc-cctgtaaaaaaaatttggttagatttcaaccctgtaatttgaagatttt 9689321  T
422 tta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||  | ||||||||||||||||||||||||| ||| ||||||||||||| ||||| |||||||||||||||||||||||||  ||||||  ||||||||     
9689322 tttgattttggaccttcatgacatcaaattataaaatttaaggtacttttgtcccttgtaatttgagagaatttcggttta--ccccctaccatatcatc 9689419  T
521 gatatttcggttcaccccc 539  Q
     ||||||||||| ||||||    
9689420 aatatttcggtttaccccc 9689438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 388 - 519
Target Start/End: Original strand, 2936188 - 2936316
Alignment:
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||| | ||||||||| ||| |||   ||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||    
2936188 tgtttagattccaaccatgtaatttgaaaattatttggttttagaccttcatgacatcaaattacaaaatttaaggtactttcgccccctgtaatttgag 2936287  T
488 agaatttcggtttaatccccctgtcatatcat 519  Q
    ||||||| ||||||   |||||||||||||||    
2936288 agaatttgggttta---cccctgtcatatcat 2936316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 388 - 611
Target Start/End: Complemental strand, 43394007 - 43393784
Alignment:
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||| ||| ||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| |||||  ||||    
43394007 tgtttaaatttcaaccctgtaatttgaagatttttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgacccttgtaacgtgag 43393908  T
488 agaatttcggtttaatccccctgtcatatcattgatatttcggttca--cccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    |||||||| |||||  |||||||  ||| ||| |||||||| ||| |  ||||  | |||||   |||||||||  ||||| ||| |||||  |  ||||    
43393907 agaatttcagttta--ccccctgctataccatcgatatttcagtttatcccccttccatatcgtcgattttgtacggtcaaaattcatgaatgtcaaaaa 43393810  T
586 ccaaaaatctttaaattacagcgttg 611  Q
    ||||||||||||||||||||| ||||    
43393809 ccaaaaatctttaaattacagggttg 43393784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 387 - 617
Target Start/End: Original strand, 3092292 - 3092521
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | |||||| |||||||||| | |||  |||||||| ||||||||||| ||| ||||||||||||||  ||||| ||||||||    
3092292 ttgtttagatttcaaccttgtaatttaaagattttttgattttaaaccttcattacatcaaattataaaatttaaggtactttcaccccctataatttga 3092391  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
    ||||||| |||||||  ||||||  |||||||||||||||||| || |||||  |  |||||   ||||||||| |||||| ||| |||||| |  |||     
3092392 gagaattacggttta--cccccttccatatcattgatatttcgatttaccccatgtcatatcgtcgattttgtacagtcaaaattaatgaaggtccaaat 3092489  T
586 ccaaaaatctttaaattacagcgttgaaatct 617  Q
     |||||||||| ||||||||| |||| |||||    
3092490 acaaaaatcttcaaattacagggttggaatct 3092521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 427 - 538
Target Start/End: Complemental strand, 11625222 - 11625113
Alignment:
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatt 526  Q
    ||||||||||||||||||||||||||| | ||||||||||||||| ||| |||| |||| |||||||||||||||  ||||||  |||||||||||||||    
11625222 tttggaccttcatgacatcaaattacataatttaaggtactttcgccccttgtagtttgtgagaatttcggttta--ccccctaccatatcattgatatt 11625125  T
527 tcggttcacccc 538  Q
    |||||| |||||    
11625124 tcggtttacccc 11625113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 24813032 - 24812901
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||| ||||||||||||| |||   ||| |||||| | | |||||||||||||| |||||||||||||| |||| ||||||||||    
24813032 ttgtttagatttcaaccctgtaatttgaagattctttggttttagacctttaaggcatcaaattacaaaatttaaggtactttcatcccttgtaatttga 24812933  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
     ||||||| ||||| ||||||||||||||||||    
24812932 aagaattttggttt-atccccctgtcatatcat 24812901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 387 - 499
Target Start/End: Original strand, 25601798 - 25601910
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||||||||||  |||   |||||||||| ||||||||||||| ||||| ||||||||| |||||||||||| |    
25601798 ttgtttagattccaaccttgtaatttgaagattttttggcttaaaaccttcatgatatcaaattacaaaatttaatgtactttcgccccctgtaatttta 25601897  T
487 gagaatttcggtt 499  Q
    |||||||||||||    
25601898 gagaatttcggtt 25601910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 390 - 611
Target Start/End: Complemental strand, 15635384 - 15635163
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||||||| || |||||||||||| |||| | |||| ||||| ||| ||||||||| |||| |||| |||||||||| ||||| ||| |||||||    
15635384 tttagattccaactctgtaatttgaagatattttgattttgaacctttatgccatcaaatttcaaaatttatggtactttcgccccctataacttgagag 15635285  T
490 aatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtcaatattgatgaagttttaaaacca 588  Q
    |||||| |||| | ||||||  |||||||| |||||||||||| |||||  || ||||||   ||||| ||  || || ||| |||||| |  |||||||    
15635284 aatttc-gttttacccccctaccatatcatcgatatttcggtttaccccatgccatatcatctattttatacggttaaaattcatgaaggtccaaaacca 15635186  T
589 aaaatctttaaattacagcgttg 611  Q
    |||||||| ||||||||| ||||    
15635185 aaaatcttcaaattacagggttg 15635163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 391 - 519
Target Start/End: Original strand, 45687693 - 45687818
Alignment:
391 ttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagaga 490  Q
    ||||||||||||||| ||||||||||||| ||| | ||| |||||||||| |||||||||| ||| ||||||||||||||  ||||| ||||||||||||    
45687693 ttagattccaaccctgtaatttgaagattctttga-tttagaccttcatggcatcaaattataaaatttaaggtactttcaccccctataatttgagaga 45687791  T
491 atttcggtttaatccccctgtcatatcat 519  Q
    |||| ||||||   |||||||||||||||    
45687792 attttggttta--tcccctgtcatatcat 45687818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 27082594 - 27082708
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||||||| || ||| ||||||||| |||   ||| ||| || |||| ||||||||||||| ||||||||||||||| ||||||||||||||    
27082594 ttgtttagattccaacactgtaacttgaagattctttggttttagacatttatgaaatcaaattacaaagtttaaggtactttcgccccctgtaatttga 27082693  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
27082694 gataattttggttta 27082708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 27195707 - 27195593
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||||||| || ||| ||||||||| |||   ||| ||| || |||| ||||||||||||| ||||||||||||||| ||||||||||||||    
27195707 ttgtttagattccaacactgtaacttgaagattctttggttttagacatttatgaaatcaaattacaaagtttaaggtactttcgccccctgtaatttga 27195608  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
27195607 gataattttggttta 27195593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 387 - 483
Target Start/End: Complemental strand, 19377191 - 19377094
Alignment:
387 ttgtttagattccaaccc-tataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatt 483  Q
    |||||||||||||||||| | |||||||||||| |||| | |||||||||||||| | |||||||||||| ||||||||||||||| ||| |||||||    
19377191 ttgtttagattccaacccctgtaatttgaagatatttttattttggaccttcatggcgtcaaattacaaaatttaaggtactttcgccccttgtaatt 19377094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 390 - 501
Target Start/End: Complemental strand, 15012066 - 15011955
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||||| ||| ||||||||||||| ||| | |||| || |||| | |||||||||||||| || |||||| |||  ||| | ||||||||||||    
15012066 tttagattccaatcctgtaatttgaagattctttgattttgaacattcacggcatcaaattacaaaattcaaggtatttttatcctcggtaatttgagag 15011967  T
490 aatttcggttta 501  Q
    ||||||||||||    
15011966 aatttcggttta 15011955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 27485060 - 27484945
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    ||||||||||| |||| | ||||||||||||||||||  | |||||| ||||||| ||| |||||| ||| |||||| ||||||   || || |||||||    
27485060 ttgtttagatttcaacgcgataatttgaagattttttttattttggatcttcatggcattaaattaaaaaatttaagatacttttaccctctataatttg 27484961  T
486 agagaatttcggttta 501  Q
    |||||||||| |||||    
27484960 agagaatttcagttta 27484945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 405 - 501
Target Start/End: Original strand, 22859340 - 22859435
Alignment:
405 tataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||||||||   |||||| ||||||| | |||| ||||||| |||| ||||||||||| || |||||||||||  ||||| ||||||    
22859340 tataatttgaagattttttggttttggatcttcatggcttcaagttacaaaatttatggtactttcgt-ccatgtaatttgagcaaattttggttta 22859435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 390 - 501
Target Start/End: Original strand, 22610110 - 22610223
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtc--ccctgtaatttgag 487  Q
    |||||||| |||| ||  |||||||||||| |||| |||||||| || |||| ||||||||| ||| ||||| ||| |||  ||  || |||||||||||    
22610110 tttagatttcaactctgcaatttgaagattatttagctttggacttttatgatatcaaattataaaatttaaagtatttttatcctccttgtaatttgag 22610209  T
488 agaatttcggttta 501  Q
    ||||||| ||||||    
22610210 agaattttggttta 22610223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 439
Target Start/End: Complemental strand, 3092527 - 3092476
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcat 439  Q
    ||||||||||||||||||| ||||||||||||||||  | |||||||||||||    
3092527 ttgtttagattccaaccctgtaatttgaagatttttgta-tttggaccttcat 3092476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 524 - 602
Target Start/End: Complemental strand, 17155771 - 17155693
Alignment:
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaatt 602  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||    
17155771 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatcttcaaatt 17155693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 442 - 487
Target Start/End: Complemental strand, 10975769 - 10975724
Alignment:
442 catcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||| | || |||||||||||||| |||||||||||    
10975769 catcaaattacaaaatctatggtactttcgtcccttgtaatttgag 10975724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 452 - 501
Target Start/End: Original strand, 14675639 - 14675688
Alignment:
452 caaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||| ||||| ||||||| | |||||||||||||||||||||| ||||||    
14675639 caaaatttaaagtacttttgccccctgtaatttgagagaattttggttta 14675688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 96; Significance: 2e-46; HSPs: 19)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 2e-46
Query Start/End: Original strand, 323 - 603
Target Start/End: Complemental strand, 8810242 - 8809963
Alignment:
323 agggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattttt 422  Q
    |||||||||||||||||  |||||||||||||| ||||||| |||| |  |||||         ||||| ||||| ||||| | ||||||||||||||||    
8810242 agggttaatatatgtttatccctgtaatattagcgatttccggtttactccctgtaaaaaaaaattgttaagatttcaaccttgtaatttgaagattttt 8810143  T
423 taactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattga 522  Q
    | | ||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||| ||||||||||||  |||||| |||| |||| ||    
8810142 ttattttggaccttcatgacatcaaattataaaatttaaggtactttcgtcccgtgtaatttgagaaaatttcggttta--ccccctatcatgtcatcga 8810045  T
523 tatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaatta 603  Q
    |||||| ||||  |||| |  |||||| |||||||||| | | || ||| |||||| || ||||| ||||||||| ||||||    
8810044 tatttcaggttaccccctgtcatatcattgattttgtacaattaaaattcatgaaggttcaaaactaaaaatcttcaaatta 8809963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 539
Target Start/End: Original strand, 13555600 - 13555815
Alignment:
323 agggttaatatatgtttgccc-ctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatttt 421  Q
    ||||||||||||||||| ||| |||||||||||| ||||||| |||| || |||||         ||| ||||||| ||||||| |||||||||||||||    
13555600 agggttaatatatgtttaccctctgtaatattagcgatttccggtttacc-cctgtaaaaaaaatttggttagatttcaaccctgtaatttgaagatttt 13555698  T
422 tta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||  | ||||||||||||||||||||||||| ||| ||||||||||||| ||||| |||||||||||||||||||||||||  ||||||  ||||||||     
13555699 tttgattttggaccttcatgacatcaaattataaaatttaaggtacttttgtcccttgtaatttgagagaatttcggttta--ccccctaccatatcatc 13555796  T
521 gatatttcggttcaccccc 539  Q
     ||||||||||| ||||||    
13555797 aatatttcggtttaccccc 13555815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 387 - 616
Target Start/End: Complemental strand, 5283900 - 5283672
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||| ||| ||||||||||||||||| | |||| ||||||||| |||||||||| ||| ||||||||||| | | ||| ||||||||||    
5283900 ttgtttagattccaatcctgtaatttgaagattttttgattttgaaccttcatggcatcaaattaaaaaatttaaggtactcttgccccttgtaatttga 5283801  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
      |||||||||||||  |||||||  ||||||| ||||||||| || |||| |  | ||||||  ||||||||| |||||| ||| |||||| || ||||    
5283800 aggaatttcggttta--ccccctgcaatatcatcgatatttcgatttaccctctaccatatcatcgattttgtagagtcaaaattcatgaaggttcaaaa 5283703  T
586 ccaaaaatctttaaattacagcgttgaaatc 616  Q
    ||||||||||| |||||| || |||||||||    
5283702 ccaaaaatcttcaaattaaagtgttgaaatc 5283672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 9780392 - 9780506
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| ||| | ||| ||||| |||| |||||||||| ||| |||||||||||||| |||||||||||||||    
9780392 ttgtttagattccaaccctgtaatttgaagattctttgattttcgacctacatggcatcaaattaaaaaatttaaggtactttcatcccctgtaatttga 9780491  T
487 gagaatttcggttta 501  Q
    || ||||||||||||    
9780492 gataatttcggttta 9780506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 394 - 617
Target Start/End: Complemental strand, 42161509 - 42161286
Alignment:
394 gattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatt 493  Q
    |||||||| ||| |||||||||||| |||||| |||||||||| | | |||||||||||||| |||||||||||||||  || |||||||||||||||||    
42161509 gattccaatcctgtaatttgaagatcttttaattttggaccttgaaggcatcaaattacaaaatttaaggtactttcgctccttgtaatttgagagaatt 42161410  T
494 tcggtttaatccccctgtcatatcattgatatttcggttcaccc-ccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaa 592  Q
    ||| ||| | || |||| |||||||| |||||||| ||| |||| | |  ||||||   ||||||||    ||| ||| |||||| |  |||| ||||||    
42161409 tcgattt-accctcctgccatatcatcgatatttcagtttaccctctgtcatatcatcaattttgtacctacaaaattcatgaaggtcaaaaatcaaaaa 42161311  T
593 tctttaaattacagcgttgaaatct 617  Q
    |||| ||||||||| ||||||||||    
42161310 tcttcaaattacagagttgaaatct 42161286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 16875937 - 16876051
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | || |||||||||| ||| | ||| |||||| ||| |||||||||||||| ||||||||| ||| ||||||||||||||||    
16875937 ttgtttagattacaaccttgtagtttgaagattctttgattttcgacctttatggcatcaaattacaaaatttaaggtatttttgtcccctgtaatttga 16876036  T
487 gagaatttcggttta 501  Q
    |||||||||||||||    
16876037 gagaatttcggttta 16876051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 16734350 - 16734215
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||| | ||||||||||||| ||| | ||| |||||||||| ||| |||||||||| ||||||||| |||||  |||||||||||||    
16734350 ttgtttagatttcaacc-tgtaatttgaagattctttgattttagaccttcatggcataaaattacaaaatttaaggtattttcgcaccctgtaatttga 16734252  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    ||||||||| |||||  || || ||||||||||||||    
16734251 gagaatttcagtttagccctcccgtcatatcattgat 16734215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 387 - 495
Target Start/End: Original strand, 49277727 - 49277835
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | ||||||||| ||| |||   |||||||||||||| |||||||||||||| ||||||||||||| | || ||||||||||     
49277727 ttgtttagattccaaccgtgtaatttgaaaattatttggttttggaccttcatggcatcaaattacaaaatttaaggtacttttgccctctgtaatttgc 49277826  T
487 gagaatttc 495  Q
    |||||||||    
49277827 gagaatttc 49277835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 323 - 486
Target Start/End: Original strand, 8678824 - 8678989
Alignment:
323 agggttaatatatgtttgcccct--gtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    ||||||||||||||||| |||||  |||||||||  |||||||||||| || |||||         |||||||||||| |||| | ||||||||||||||    
8678824 agggttaatatatgtttacccctatgtaatattatcgatttccagtttaccccctgtaaaaaaaa-ttgtttagattcaaaccttgtaatttgaagattt 8678922  T
421 ttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||  | |||||||||||||| |||||||||||||| ||||||||||||||| | | ||||||||||    
8678923 tttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgcctcttgtaatttga 8678989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 49533332 - 49533218
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||  |||| ||||||||||||||| |||   ||||||||||||||||||||||||||||| ||||| ||| ||| | ||| | ||||||||    
49533332 ttgtttagattataaccttataatttgaagattatttggttttggaccttcatgacatcaaattacaaaatttaacgtatttttgccccttataatttga 49533233  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
49533232 gagaatttcgattta 49533218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 469
Target Start/End: Complemental strand, 25786388 - 25786326
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtacttt 469  Q
    ||||||||||||| ||| | |||| ||||||||| ||||||||||||||||||||||||||||    
25786388 taatttgaagattctttgattttgaaccttcatggcatcaaattacaaattttaaggtacttt 25786326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 388 - 501
Target Start/End: Complemental strand, 21744998 - 21744885
Alignment:
388 tgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||||||||||| | ||||||||| ||| |||   ||||||  |||||||| | |||||||||| ||| |||| ||||||   | |||||||||||    
21744998 tgtttagattccaaccatgtaatttgaatattctttggttttggattttcatgacgtgaaattacaaaattttaggtgctttcgcttcttgtaatttgag 21744899  T
488 agaatttcggttta 501  Q
    ||||||||||||||    
21744898 agaatttcggttta 21744885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 524 - 605
Target Start/End: Original strand, 32681909 - 32681990
Alignment:
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   |||||||||  ||||| ||| |||||| |||||||||||||||||||||||||||    
32681909 atttcggtttacccctgctatatcttcgattttgtactgtcaaaattcatgaaggtttaaaaccaaaaatctttaaattaca 32681990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 407 - 501
Target Start/End: Original strand, 29172622 - 29172715
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||| ||||||||| | |||||||||| ||| |||||| || |||| |||||||||| |||||||  ||||||||||| |||||| ||||||    
29172622 taatttggagatttttttattttggaccttaatggcatcaagtttcaaaatttaaggtacgttcgtcca-tgtaatttgagcgaattttggttta 29172715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 387 - 441
Target Start/End: Original strand, 29700563 - 29700617
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||||||||||| | ||||||||||| ||||| ||| |||||||||||    
29700563 ttgtttagattccaaccctgttatttgaagattctttaatttttgaccttcatga 29700617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 439
Target Start/End: Complemental strand, 23091928 - 23091876
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcat 439  Q
    ||||||||||||||||| | ||||||||||||||||||  |||| ||||||||    
23091928 ttgtttagattccaaccttgtaatttgaagattttttagttttgaaccttcat 23091876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 390 - 501
Target Start/End: Original strand, 37589461 - 37589572
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||| ||| |||||||| |||||| ||||  ||||||| | ||| ||||||||||  ||| ||||||||||| |  | || ||||||| ||| |    
37589461 tttagattccgaccatataatttaaagattctttagatttggacatacattacatcaaattttaaaatttaaggtactcttataccatgtaattagagcg 37589560  T
490 aatttcggttta 501  Q
    ||||| ||||||    
37589561 aattttggttta 37589572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 524 - 605
Target Start/End: Original strand, 7913324 - 7913405
Alignment:
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  |||||||||||| || ||||||||    
7913324 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatattcaaattaca 7913405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 524 - 605
Target Start/End: Complemental strand, 21507989 - 21507908
Alignment:
524 atttcggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| ||||| ||||||||   ||||||||| |||||| ||| |||||| |  |||||||||||| || ||||||||    
21507989 atttcggtttacccctgctatatcttcgattttgtacagtcaaaattcatgaaggtccaaaaccaaaaatattcaaattaca 21507908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 6e-43; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 6e-43
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 7308308 - 7308175
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||| ||||||||||||||||||||||||||||||| | ||| |||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||    
7308308 ttgttcagattccaaccctataatttgaagatttttttatttttgaccttcatggcatcaaattacaaaatttaaggtactttcg-cccctgtaatttga 7308210  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||||||||||||  ||||||| ||||||||||||    
7308209 gagaatttcggttta--ccccctgccatatcattgat 7308175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 323 - 538
Target Start/End: Original strand, 55257638 - 55257854
Alignment:
323 agggttaatatatgtttgcccc---tgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatt 419  Q
    ||||||||||||||||| ||||   ||||||||||| ||||||| |||| || |||||         |||||||||||||||||||||||||||||||||    
55257638 agggttaatatatgtttaccccccctgtaatattagcgatttccggtttaccccctgtaaaaaaaa-ttgtttagattccaaccctataatttgaagatt 55257736  T
420 ttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcat 519  Q
    |||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| | |||||||| |||||||| |||| |  |||||| ||||||||    
55257737 tttttattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttataatttgatagaatttcagttt-acacccctgccatatcat 55257835  T
520 tgatatttcggttcacccc 538  Q
     |||||||| ||| |||||    
55257836 cgatatttcagtttacccc 55257854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 387 - 528
Target Start/End: Complemental strand, 43426505 - 43426365
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| ||||||||||||||||| | ||| |||||||||  |||||||||||||| ||||||||||||| | ||||||||||||||    
43426505 ttgtttagattcgaaccctgtaatttgaagattttttgattttagaccttcatagcatcaaattacaaaatttaaggtacttttgccccctgtaatttga 43426406  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttc 528  Q
    |||||||||||||| | ||||||| |||||||| ||||||||    
43426405 gagaatttcggttt-acccccctgccatatcatcgatatttc 43426365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 387 - 605
Target Start/End: Complemental strand, 17030828 - 17030611
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    |||||| |||| ||||||| |||||| ||||||||||  | |||||||||||||| |||||||||||||| ||||||||||||||  ||||||||| |||    
17030828 ttgttttgatttcaaccctctaatttaaagatttttttgattttggaccttcatggcatcaaattacaaaatttaaggtactttc-acccctgtaaattg 17030730  T
486 agagaatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    ||||||||| ||||||  || |||| |||||||| |||||||| ||||  | || |  |||||| |||||||||| |||||| ||| |||||| |  |||    
17030729 agagaattttggttta--cctcctgccatatcatcgatatttcaggttaccacctgacatatcattgattttgtacagtcaaaattcatgaaggtccaaa 17030632  T
585 accaaaaatctttaaattaca 605  Q
    |||||||||||| ||||||||    
17030631 accaaaaatcttcaaattaca 17030611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 73; E-Value: 8e-33
Query Start/End: Original strand, 427 - 617
Target Start/End: Original strand, 25124872 - 25125061
Alignment:
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatt 526  Q
    |||||||||||||| |||||||||| ||| ||||||||||||||| ||| ||||||||| ||||||||| |||||  ||||||| |||||||| ||||||    
25124872 tttggaccttcatggcatcaaattataaaatttaaggtactttcgccccttgtaatttgggagaatttcagttta--ccccctgccatatcatcgatatt 25124969  T
527 tcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    || ||| ||||||  | ||||||  ||||||||| |||||| ||| |||||| |  ||||||||||||||| |||||| || | ||||||||    
25124970 tcagtttacccccttccatatcatcgattttgtacagtcaaaattcatgaaggtcaaaaaccaaaaatcttcaaattatagggatgaaatct 25125061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 387 - 519
Target Start/End: Original strand, 18359295 - 18359424
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| ||||  ||| ||  | |||| |||||||||||||| ||||||||||||| |||| |||||||||||    
18359295 ttgtttagattccaaccctgtaatttgaagattctttagttttagatatacatggcatcaaattacaaaatttaaggtactttagtccgctgtaatttga 18359394  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    ||||||||||| |||   |||||||||||||||    
18359395 gagaatttcggatta---cccctgtcatatcat 18359424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 387 - 502
Target Start/End: Complemental strand, 25159129 - 25159014
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||| | ||||||||| ||||||| | ||||||| |||||| |||||||||||||| ||||||||| ||||| | ||||||||||||    
25159129 ttgtttagattctaaccttgtaatttgaatattttttgattttggacgttcatggcatcaaattacaaaatttaaggtattttcgcctcctgtaatttga 25159030  T
487 gagaatttcggtttaa 502  Q
    |||||||| |||||||    
25159029 gagaattttggtttaa 25159014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 387 - 538
Target Start/End: Complemental strand, 17582613 - 17582462
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta--actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||| |||| |||| | |||||||||||||||||   | |||||||||||||  |||||||||||||| ||||||||||||||| ||| ||||||||    
17582613 ttgtttaaattcaaaccttgtaatttgaagatttttttttattttggaccttcatagcatcaaattacaaaatttaaggtactttcgccccttgtaattt 17582514  T
485 gagagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc 538  Q
    |||||| ||||||||||  || |||| ||||| || |||||||| ||| |||||    
17582513 gagagattttcggttta--cctcctgccatataatcgatatttcagttaacccc 17582462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 387 - 494
Target Start/End: Original strand, 7013229 - 7013336
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||  |||||||||||||||| ||| | ||||||| ||||||  ||||||||||||| |||||| |||||||| ||| ||||||||||    
7013229 ttgtttagatttcaattctataatttgaagattatttgattttggactttcatggtatcaaattacaaaatttaagatactttcgccccatgtaatttga 7013328  T
487 gagaattt 494  Q
    ||||||||    
7013329 gagaattt 7013336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 23070058 - 23070172
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| |||||   |||||| |||||||||| | |||| |||||| ||||||||||||| ||| ||||||||||||||| ||| | ||||||||    
23070058 ttgtttagatttcaacctagtaatttaaagattttttgattttgaaccttcgtgacatcaaattataaaatttaaggtactttcgccccttctaatttga 23070157  T
487 gagaatttcggttta 501  Q
    |||||||||| ||||    
23070158 gagaatttcgattta 23070172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 45008176 - 45008061
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    |||||||||||| ||| || |||||||||||||||||  | ||||||| ||| || |||||||||||||| ||||||| ||||||| ||| |||||||||    
45008176 ttgtttagattctaactctgtaatttgaagattttttttattttggacattcttggcatcaaattacaaaatttaaggaactttcgccccttgtaatttg 45008077  T
486 agagaatttcggttta 501  Q
    | | ||||||||||||    
45008076 ataaaatttcggttta 45008061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 5303750 - 5303666
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||||||||||||||| ||||||||||||| |||   ||| ||||||||||||||||||||||| |  ||||||||||||||    
5303750 ttgtttagattccaaccctgtaatttgaagattctttggttttagaccttcatgacatcaaattacagaacttaaggtactttcg 5303666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 390 - 519
Target Start/End: Complemental strand, 30226366 - 30226239
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||||| |  | ||||||||||||| ||| | ||||||||||||||||| ||||||||||| |||| |||||||||  ||| |||| ||||||      
30226366 tttagattccatcattgtaatttgaagattctttgattttggaccttcatgacaacaaattacaaaatttatggtactttcaccccttgtagtttgagca 30226267  T
490 aatttcggtttaatccccctgtcatatcat 519  Q
    |||||  |||||  ||||||||||||||||    
30226266 aattttagttta--ccccctgtcatatcat 30226239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 405 - 501
Target Start/End: Complemental strand, 37050262 - 37050166
Alignment:
405 tataatttgaagattttttaactttggaccttcat-gacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||||||||||| ||| | ||||||| ||| | |||||||| ||||||| ||||||||||||||| ||| |||||||||||  ||||||| ||||    
37050262 tataatttgaagattctttgattttggacattctttgacatcaa-ttacaaaatttaaggtactttcgccccttgtaatttgagcaaatttcgattta 37050166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 540 - 611
Target Start/End: Complemental strand, 17582310 - 17582239
Alignment:
540 gctatatcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttg 611  Q
    ||||||||| |||||||||||  |||| ||| |||||| || ||||| ||||||||||||||||||| ||||    
17582310 gctatatcattgattttgtaatttcaaaattcatgaaggttcaaaacgaaaaatctttaaattacagggttg 17582239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 427 - 494
Target Start/End: Complemental strand, 20275600 - 20275533
Alignment:
427 tttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaattt 494  Q
    |||||||||| ||||||||||||| |||| ||||||||| ||| | |  ||||||||| |||||||||    
20275600 tttggacctttatgacatcaaatttcaaaatttaaggtatttttgccaactgtaatttaagagaattt 20275533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 320 - 368
Target Start/End: Original strand, 7308039 - 7308088
Alignment:
320 taaagggttaatatatgttt-gcccctgtaatattagtgatttccagttt 368  Q
    ||||||||||||||||||||  |||||||||||||||||| |||| ||||    
7308039 taaagggttaatatatgtttaccccctgtaatattagtgaattccggttt 7308088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 324 - 361
Target Start/End: Original strand, 25158790 - 25158827
Alignment:
324 gggttaatatatgtttgcccctgtaatattagtgattt 361  Q
    |||||||||||||||| ||||||||||||||| |||||    
25158790 gggttaatatatgtttacccctgtaatattagcgattt 25158827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 88; Significance: 9e-42; HSPs: 12)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 9e-42
Query Start/End: Original strand, 387 - 616
Target Start/End: Complemental strand, 20355314 - 20355086
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||| ||| ||||||||||||||||| | |||| ||||| ||| |||||||||| ||| ||||||||||| | | ||| ||||||||||    
20355314 ttgtttagattccaatcctgtaatttgaagattttttgattttgaaccttgatggcatcaaattaaaaaatttaaggtactcttgccccttgtaatttga 20355215  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc-gctatatcactgattttgtaaagtcaatattgatgaagttttaaaa 585  Q
      |||||||||||||  |||||||  ||||||| ||||||| |||| ||||||  | ||||||  ||||||||| |||||| ||| |||||| || ||||    
20355214 aggaatttcggttta--ccccctgcaatatcatcgatattttggtttaccccctaccatatcatcgattttgtacagtcaaaattcatgaaggttcaaaa 20355117  T
586 ccaaaaatctttaaattacagcgttgaaatc 616  Q
    ||||||||||| ||||||||| |||||||||    
20355116 ccaaaaatcttcaaattacagtgttgaaatc 20355086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 387 - 617
Target Start/End: Complemental strand, 42779107 - 42778875
Alignment:
387 ttgtttagattccaaccctataatttgaagattttt-----taactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaa 481  Q
    ||||||||||||||||||| | |||||||  |||||     | | ||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||    
42779107 ttgtttagattccaaccctgttatttgaatttttttattttttattttggaccttcatgacatcaaattacaaaatttaaggtactttcg-cccttgtaa 42779009  T
482 tttgagagaatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttt 580  Q
    ||||||||||||||||||||    |||| ||||||||| |||||||| ||||  |||| || |||||| |||||||||| || ||| ||| |||||| ||    
42779008 tttgagagaatttcggttta---tccctatcatatcatcgatatttcaggttaccccctgccatatcattgattttgtacagccaaaattcatgaaggtt 42778912  T
581 taaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    ||||||| ||| |||| ||||||||| |||| |||||    
42778911 taaaaccgaaattcttcaaattacagagttggaatct 42778875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 78; E-Value: 8e-36
Query Start/End: Original strand, 387 - 527
Target Start/End: Original strand, 21144023 - 21144161
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||||||| | |||||||||||||| |||||||||||||| ||| | ||||||| | ||| ||||||||||    
21144023 ttgtttagattccaaccctgtaatttgaagattttttgattttggaccttcatggcatcaaattacaaaatttgatgtacttttgccccttgtaatttga 21144122  T
487 gagaatttcggtttaatccccctgtcatatcattgatattt 527  Q
    |||||||| ||||||  ||| |||||||||||| |||||||    
21144123 gagaattttggttta--ccctctgtcatatcatcgatattt 21144161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 387 - 523
Target Start/End: Original strand, 13153599 - 13153733
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||||||| || | |||||||||||||  ||||||| |||||| |||| |||||||||||||| ||||||||||    
13153599 ttgtttagattccaaccttgtaatttgaagatttctttattttggaccttcatagcatcaaaatacaaaatttacggtactttcgtcccttgtaatttga 13153698  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||||||||||||  ||||||| ||||| ||||||    
13153699 gagaatttcggttta--ccccctgccatataattgat 13153733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 15399676 - 15399792
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta--actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    |||||||||| |||||||| |||||||||||||||||   | ||||||||||||| ||||||||||||||| ||||||||||||||| ||| ||||||||    
15399676 ttgtttagatcccaaccctgtaatttgaagatttttttttattttggaccttcataacatcaaattacaaaatttaaggtactttcgccccttgtaattt 15399775  T
485 gagagaatttcggttta 501  Q
    |||| ||||||| ||||    
15399776 gagataatttcgattta 15399792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 539
Target Start/End: Complemental strand, 37869611 - 37869460
Alignment:
387 ttgtttagatt-ccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttg 485  Q
    ||||||||||| |||||| | ||||||||||||| ||| | |||||||||||||| |||||||||||||| ||||||||||||| | ||| | |||||||    
37869611 ttgtttagatttccaaccttgtaatttgaagattctttgattttggaccttcatgtcatcaaattacaaaatttaaggtacttttgccccttataatttg 37869512  T
486 agagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc 539  Q
    ||||||||||  ||||  || |||| |||||||| |||||||| ||| ||||||    
37869511 agagaatttctattta--cctcctgccatatcatcgatatttcagtttaccccc 37869460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 407 - 501
Target Start/End: Complemental strand, 17668830 - 17668736
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||| |||||| ||| | ||||||| ||||||| |||||| |  ||| ||||||||||||||| |||||||||||||||||||||| ||||||    
17668830 taatttaaagattctttgattttggactttcatgatatcaaaatttaaaatttaaggtactttcgccccctgtaatttgagagaattttggttta 17668736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 407 - 483
Target Start/End: Complemental strand, 31567880 - 31567804
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatt 483  Q
    |||||||||||||||||   ||||||||||||||| ||||||||||||| ||||  ||||||||| | |||||||||    
31567880 taatttgaagattttttggttttggaccttcatgatatcaaattacaaaatttatagtactttcgcctcctgtaatt 31567804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 405 - 443
Target Start/End: Complemental strand, 21125374 - 21125336
Alignment:
405 tataatttgaagattttttaactttggaccttcatgaca 443  Q
    ||||||||||||||||||||  |||||||||||||||||    
21125374 tataatttgaagattttttagttttggaccttcatgaca 21125336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Complemental strand, 21144258 - 21144205
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||||||||| | |||||||||||| |||||  |||||||||||||||    
21144258 ttgtttagattccaaccttgtaatttgaagat-ttttaggtttggaccttcatga 21144205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 551 - 605
Target Start/End: Original strand, 31312692 - 31312746
Alignment:
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattaca 605  Q
    ||||||||| |||||| ||| |||||| | |||||||||||||||| ||||||||    
31312692 gattttgtacagtcaaaattcatgaaggtctaaaaccaaaaatcttcaaattaca 31312746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 551 - 611
Target Start/End: Original strand, 18231998 - 18232059
Alignment:
551 gattttgtaaagtcaatattgatgaagttttaaaaccaaa-aatctttaaattacagcgttg 611  Q
    ||||||||| |||||| ||| |||||| || ||||||||| |||||||||||||||| ||||    
18231998 gattttgtagagtcaaaattcatgaaggttcaaaaccaaagaatctttaaattacagggttg 18232059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 86; Significance: 1e-40; HSPs: 20)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 390 - 605
Target Start/End: Original strand, 25059868 - 25060082
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    ||||||||  || ||| |||||| || ||||||| | |||||||||||| |||||||||||||||| ||||||||| ||||| ||| |||||||||||||    
25059868 tttagattttaatcctctaatttaaatattttttgattttggaccttcaagacatcaaattacaaaatttaaggtattttcgccccttgtaatttgagag 25059967  T
490 aatttcggtttaatccccctgtcatatcattgatatttc-ggttcacccccgctatatcactgattttgtaaagtcaatattgatgaagttttaaaacca 588  Q
     |||||||||||  |||||||||||||||| |||||||| ||||  |||| || |||||| |||||||||| | |||| ||| |||||| || ||||| |    
25059968 catttcggttta--ccccctgtcatatcatcgatatttcaggttaccccctgccatatcattgattttgtacaatcaaaattcatgaaggttcaaaacta 25060065  T
589 aaaatctttaaattaca 605  Q
    |||||||| ||||||||    
25060066 aaaatcttcaaattaca 25060082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 13437117 - 13436988
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||| |||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||    
13437117 ttgtttagattccaaccgtgtaatttgatgattttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgccccttgtaatttga 13437018  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    |||||||| ||||||   |||||||||||||||    
13437017 gagaattttggttta---cccctgtcatatcat 13436988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 387 - 603
Target Start/End: Complemental strand, 5469592 - 5469375
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| | |||||||||  |||||| | |||||||||||||| ||||||| |||||| ||||||||| ||| | |||||||||| |||    
5469592 ttgtttagattccaaccttgtaatttgaattttttttgattttggaccttcatggcatcaaactacaaaatttaaggtatttttgccccctgtaatatga 5469493  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcaccccc--gctatatcactgattttgtaaagtcaatattgatgaagttttaaa 584  Q
    |||||||||||||| | ||||||   ||||||||||||||||  || | ||||  |||||||||  |||||||||  ||||| ||| |||||| |  |||    
5469492 gagaatttcggttt-acccccctactatatcattgatatttcaatttatccccttgctatatcatcgattttgtatggtcaaaattaatgaagatccaaa 5469394  T
585 accaaaaatctttaaatta 603  Q
    || ||||||||| ||||||    
5469393 actaaaaatcttcaaatta 5469375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 387 - 538
Target Start/End: Original strand, 17890132 - 17890281
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| |||||| |||||||||||  |||||| | ||||  |||||||||||||| |||||||||||| |||||  ||||||||||    
17890132 ttgtttagattccaaccctgtaatttaaagattttttat-tttggatcctcatagcatcaaattacaaaatttaaggtacttccgtccattgtaatttga 17890230  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc 538  Q
    |||||||||||||| | | |  ||||||||||| |||||||| ||| |||||    
17890231 gagaatttcggttt-acctctatgtcatatcatcgatatttcagtttacccc 17890281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Complemental strand, 33864321 - 33864207
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| |||   |||||||||| ||| |||||||||||||| ||||||||| ||||| | ||||||||||      
33864321 ttgtttagattccaaccctgtaatttgaagattctttggttttggacctttatggcatcaaattacaaaatttaaggtattttcgcctcctgtaattttc 33864222  T
487 gagaatttcggttta 501  Q
    |||||||||||||||    
33864221 gagaatttcggttta 33864207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 33916601 - 33916715
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||||||| |||   |||||||||| ||| |||||||||||||| ||||||||| ||||| | ||||||||||      
33916601 ttgtttagattccaaccctgtaatttgaagattctttggttttggacctttatggcatcaaattacaaaatttaaggtattttcgcctcctgtaattttc 33916700  T
487 gagaatttcggttta 501  Q
    |||||||||||||||    
33916701 gagaatttcggttta 33916715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 387 - 519
Target Start/End: Complemental strand, 44228543 - 44228414
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||| ||||||  ||||||||||||| |||   ||||||||||| || ||||||||| |||| ||||||||||||||| |||||||||||| |    
44228543 ttgtttagattgcaacccagtaatttgaagattctttgggtttggaccttcgtggcatcaaatttcaaaatttaaggtactttcg-cccctgtaatttaa 44228445  T
487 gagaatttcggtttaatccccctgtcatatcat 519  Q
    |  ||||||||||||  ||||||| ||||||||    
44228444 gcaaatttcggttta--ccccctggcatatcat 44228414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 387 - 487
Target Start/End: Complemental strand, 7261587 - 7261487
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||||| ||||||||| ||| |||   |||||||||||||||||||||||| |||| || ||||||||||   ||||||||||||||    
7261587 ttgtttagattccaaccctgtaatttgaacattctttggttttggaccttcatgacatcaaatttcaaaattgaaggtactttgcccccctgtaatttga 7261488  T
487 g 487  Q
    |    
7261487 g 7261487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 387 - 523
Target Start/End: Complemental strand, 9240736 - 9240602
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    |||||||||||| |||||| ||| ||||||||| || |  |||  ||||||||| ||||||||||  || ||||||||||||||||   |||||||||||    
9240736 ttgtttagattcaaaccctgtaacttgaagattcttcagttttaaaccttcatggcatcaaattatgaaatttaaggtactttcgtattctgtaatttga 9240637  T
487 gagaatttcggtttaatccccctgtcatatcattgat 523  Q
    ||||||||| |||||  ||| || |||||||||||||    
9240636 gagaatttcagttta--ccctctttcatatcattgat 9240602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 322 - 455
Target Start/End: Original strand, 22315143 - 22315278
Alignment:
322 aagggttaatatatgtttgc--ccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagatt 419  Q
    |||||||||||||||||| |  |||||||||||||| ||||||  |||| |  |||||         ||||||||||||||||||| |||||||||||||    
22315143 aagggttaatatatgtttactcccctgtaatattagcgatttctggtttactccctgtaaaaaaaaattgtttagattccaaccctgtaatttgaagatt 22315242  T
420 ttttaactttggaccttcatgacatcaaattacaaa 455  Q
    |||| | |||||||||||||| ||||| ||||||||    
22315243 ttttgattttggaccttcatggcatcatattacaaa 22315278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 407 - 501
Target Start/End: Original strand, 22151973 - 22152067
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||||||||||   |||||||||||||||||||||||| |||| |||| ||||||| || || ||||||||| ||  |||||| |||||    
22151973 taatttgaagatttttttgttttggaccttcatgacatcaaattgcaaaatttatggtacttacgcccactgtaatttaagcaaatttcagttta 22152067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 387 - 469
Target Start/End: Complemental strand, 44078798 - 44078716
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtacttt 469  Q
    ||||||||||||||||| | ||||||||||||  |||   ||||||||||| | |||| ||||| |||| |||||||||||||    
44078798 ttgtttagattccaaccttgtaatttgaagatccttttgttttggaccttcctaacataaaatttcaaaatttaaggtacttt 44078716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 407 - 471
Target Start/End: Complemental strand, 5883076 - 5883012
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    |||||| |||||| |||  ||||| |||||||||||||||||||  ||| |||||||||||||||    
5883076 taattttaagattatttggctttgtaccttcatgacatcaaattttaaaatttaaggtactttcg 5883012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 422
Target Start/End: Original strand, 5469355 - 5469390
Alignment:
387 ttgtttagattccaaccctataatttgaagattttt 422  Q
    ||||||||||||||||| ||||||||||||||||||    
5469355 ttgtttagattccaaccttataatttgaagattttt 5469390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 413 - 501
Target Start/End: Original strand, 23652563 - 23652647
Alignment:
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    | |||||||||| |||||||| ||||    
23652563 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg----ccgtaatttgagcgaatttcgattta 23652647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 583 - 617
Target Start/End: Original strand, 1701191 - 1701225
Alignment:
583 aaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    |||||||||||||||||||||||| ||||||||||    
1701191 aaaccaaaaatctttaaattacagggttgaaatct 1701225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 431 - 523
Target Start/End: Original strand, 16639582 - 16639673
Alignment:
431 gaccttcatgacatcaaattacaaattttaaggtactttcgtccc-ctgtaatttgagagaatttcggtttaatccccctgtcatatcattgat 523  Q
    |||||| ||||  |||||||||||| |||| |||||||||| |||  |||||||||||| ||||| ||||||  |||||| |||||| ||||||    
16639582 gacctttatgatgtcaaattacaaaatttatggtactttcgcccctttgtaatttgagaaaattttggttta--ccccctatcatattattgat 16639673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 23621217 - 23621275
Alignment:
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    
23621217 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg 23621275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 23737996 - 23738054
Alignment:
413 gaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcg 471  Q
    ||||||| ||| | ||||||| |||||||||||||||| |||| ||||| |||||||||    
23737996 gaagattctttgagtttggactttcatgacatcaaatttcaaaatttaaagtactttcg 23738054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 387 - 436
Target Start/End: Complemental strand, 18426783 - 18426734
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggacctt 436  Q
    ||||||||||||||| ||| ||||||||||||||||| |  |||||||||    
18426783 ttgtttagattccaatcctgtaatttgaagatttttttatcttggacctt 18426734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 82; Significance: 3e-38; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 407 - 539
Target Start/End: Complemental strand, 9662966 - 9662836
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccc 506  Q
    ||||||||||||||||| | |||| |||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| |||||  |||    
9662966 taatttgaagattttttgattttgaaccttcatgacatcaaattacaaaatttaaggtacttttgccccctgtaatttgagagaatttcagttta--ccc 9662869  T
507 cctgtcatatcattgatatttcggttcaccccc 539  Q
    | ||||||||||||||||||| |||| ||||||    
9662868 cttgtcatatcattgatattttggtttaccccc 9662836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 390 - 501
Target Start/End: Complemental strand, 25167150 - 25167039
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||||||||  | ||||||||||||| ||| | |||||| ||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||    
25167150 tttagattccaactgtgtaatttgaagattatttgattttggatcttcatggcatcaaattacaaaatttaaggtactttcgtcccttgtaatttgagag 25167051  T
490 aatttcggttta 501  Q
    ||||||||||||    
25167050 aatttcggttta 25167039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 606
Target Start/End: Complemental strand, 9044699 - 9044480
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||| ||||||||| | ||||||||||||| ||| | |||||||||||||| |||||||||| | | |||||| |||||||  | || |||||||||    
9044699 ttgtttaaattccaaccttgtaatttgaagattatttgattttggaccttcatggcatcaaattatataatttaagatactttcacctcccgtaatttga 9044600  T
487 gagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccc-cgctatatcactgattttgtaaagtc-aatattgatgaagttttaaa 584  Q
    |||||||| ||||||  ||||||| |||||||| |||||||| ||| |||||  || ||||||  ||||||||| |||| || ||| |||||| |  |||    
9044599 gagaattttggttta--ccccctgccatatcatcgatatttcagtttaccccttgccatatcatcgattttgtatagtcaaaaattcatgaaggtccaaa 9044502  T
585 accaaaaatctttaaattacag 606  Q
    | ||||| |||| |||||||||    
9044501 atcaaaattcttcaaattacag 9044480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 387 - 501
Target Start/End: Original strand, 3816552 - 3816665
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttga 486  Q
    ||||||||||||||||| |||||||| |||||| |||   |||| | ||||||| |||||||||| ||| ||||||||||||||| ||||||||||||||    
3816552 ttgtttagattccaacc-tataatttaaagattctttggttttgaatcttcatggcatcaaattataaaatttaaggtactttcgccccctgtaatttga 3816650  T
487 gagaatttcggttta 501  Q
    || ||||| ||||||    
3816651 gaaaattttggttta 3816665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 391 - 497
Target Start/End: Complemental strand, 20757700 - 20757595
Alignment:
391 ttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagaga 490  Q
    |||||||||||||||| ||||||||||||||||   ||||| | |||||||||||||||||||||  |||||||||||||| ||| |||||||| |||      
20757700 ttagattccaacccta-aatttgaagattttttggttttggtcgttcatgacatcaaattacaaaacttaaggtactttcgccccttgtaattttagaag 20757602  T
491 atttcgg 497  Q
    |||||||    
20757601 atttcgg 20757595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 390 - 470
Target Start/End: Original strand, 33198591 - 33198671
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc 470  Q
    ||||||||||| |||||||||||||||||| |||   ||| ||| |||||| |||||||||||||| ||||||| ||||||    
33198591 tttagattccatccctataatttgaagattctttggttttagacattcatggcatcaaattacaaaatttaaggcactttc 33198671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 494
Target Start/End: Original strand, 334912 - 335019
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttc-gtcccctgtaatttg 485  Q
    |||||||||||  |||| | ||||||||||| ||||||  || |||| |||||||||| |||||| ||| ||||| ||||||||  |||| ||||||||     
334912 ttgtttagattttaaccttgtaatttgaaga-tttttagtttaggacattcatgacattaaattataaaatttaaagtactttcattcccttgtaattta 335010  T
486 agagaattt 494  Q
    |||||||||    
335011 agagaattt 335019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 407 - 487
Target Start/End: Original strand, 6759744 - 6759824
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    |||||||| |||| ||||  ||||||  ||||||| |||||||| |||| ||||||||||||||  ||||| |||||||||    
6759744 taatttgatgattctttagttttggattttcatgagatcaaatttcaaaatttaaggtactttcaccccctttaatttgag 6759824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 387 - 441
Target Start/End: Complemental strand, 33200067 - 33200013
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatga 441  Q
    ||||||||||| ||||||| ||||||||||||| ||| | |||||||||| ||||    
33200067 ttgtttagattacaaccctgtaatttgaagattctttgattttggacctttatga 33200013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 80; Significance: 5e-37; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 321 - 524
Target Start/End: Complemental strand, 26044 - 25844
Alignment:
321 aaagggttaatatatgtttgcccctgtaatattagtgatttccagtttgcctcctgtnnnnnnnnnttgtttagattccaaccctataatttgaagattt 420  Q
    ||||||||||||||||||| ||||  ||||||||| ||||||| |||| || | |||         || |||||||||||||||| |||||||||| |||    
26044 aaagggttaatatatgtttacccccttaatattagcgatttccggtttaccccttgtaaaaaaaa-ttatttagattccaaccct-taatttgaaggttt 25947  T
421 tttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcatt 520  Q
    ||| | |||||||||||||| |||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| | | ||||||||||||||     
25946 tttgattttggaccttcatggcatcaaattacaaaatttaaggtactttcgccccttgtaatttgagagaatttcggttt-accaccctgtcatatcatc 25848  T
521 gata 524  Q
    ||||    
25847 gata 25844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 76; Significance: 1e-34; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 390 - 532
Target Start/End: Complemental strand, 82444 - 82304
Alignment:
390 tttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagag 489  Q
    |||||||| ||||||| |||||| |||||| ||| | ||||||||||||||| ||||||||||||| ||||||||||||||| ||| |||||||||||||    
82444 tttagatttcaaccctttaatttaaagattgtttgattttggaccttcatgatatcaaattacaaaatttaaggtactttcgccccatgtaatttgagag 82345  T
490 aatttcggtttaatccccctgtcatatcattgatatttcggtt 532  Q
    ||||||||||||  |||||||  ||||||| ||||||| ||||    
82344 aatttcggttta--ccccctgctatatcatcgatattttggtt 82304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 63; Significance: 8e-27; HSPs: 1)
Name: scaffold0188
Description:

Target: scaffold0188; HSP #1
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 387 - 484
Target Start/End: Complemental strand, 13384 - 13286
Alignment:
387 ttgtttagattccaaccctataatttgaagatttttta-actttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaattt 484  Q
    ||||||||||||||||| | |||||||||||||||||  | ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||    
13384 ttgtttagattccaaccttgtaatttgaagatttttttgattttggaccttcatgacatcaaattacaaaatttaaggtactttcgccccatgtaattt 13286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142 (Bit Score: 48; Significance: 7e-18; HSPs: 2)
Name: scaffold0142
Description:

Target: scaffold0142; HSP #1
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 447 - 617
Target Start/End: Original strand, 34884 - 35054
Alignment:
447 aattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggtttaatccccctgtcatatcattgatatttcggttcacccccgct-ata 545  Q
    ||||| ||| ||||||||||||||  ||| ||||||||||||| |||| ||||| | ||| |||||||||||| |||||||| ||| ||||||  | |||    
34884 aattaaaaaatttaaggtactttctccccatgtaatttgagagtattttggttt-acccctctgtcatatcatagatatttcagtttaccccctatcata 34982  T
546 tcactgattttgtaaagtcaatattgatgaagttttaaaaccaaaaatctttaaattacagcgttgaaatct 617  Q
    |||  ||||||||| |||||| ||| |||||| |   ||||  |||||||| ||||||||| ||||||||||    
34983 tcatcgattttgtatagtcaaaattcatgaaggtccgaaacacaaaatcttcaaattacagggttgaaatct 35054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 387 - 451
Target Start/End: Original strand, 34500 - 34564
Alignment:
387 ttgtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaatta 451  Q
    ||||||| ||||||||| | |||||| |||||||||| |  ||||||||||||| ||||||||||    
34500 ttgtttaaattccaaccttgtaattttaagattttttgatcttggaccttcatggcatcaaatta 34564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 46; Significance: 1e-16; HSPs: 1)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 408 - 501
Target Start/End: Original strand, 23194 - 23287
Alignment:
408 aatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgagagaatttcggttta 501  Q
    |||||||||| ||||| | ||| |||||||||| |||||||||||||| ||||| ||| || || || || |||||||||||||||||||||||    
23194 aatttgaagactttttgattttagaccttcatggcatcaaattacaaaatttaacgtatttccgccctctataatttgagagaatttcggttta 23287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 407 - 487
Target Start/End: Complemental strand, 306757 - 306678
Alignment:
407 taatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgag 487  Q
    ||||||||||||| |||   |||||||||||||| |||||||||||||| |||| |||||||||| |||||||||||||||    
306757 taatttgaagattctttggttttggaccttcatggcatcaaattacaaaatttatggtactttcg-cccctgtaatttgag 306678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 389 - 501
Target Start/End: Complemental strand, 316699 - 316587
Alignment:
389 gtttagattccaaccctataatttgaagattttttaactttggaccttcatgacatcaaattacaaattttaaggtactttcgtcccctgtaatttgaga 488  Q
    ||||||||||||||||| |||| ||||  |||||| | ||| || |||||||||||||||||   || ||||| ||| ||| |||  ||||||||||||     
316699 gtttagattccaaccctctaatatgaaatttttttgattttagatcttcatgacatcaaattttgaaatttaaagtatttttgtcttctgtaatttgagt 316600  T
489 gaatttcggttta 501  Q
     |||||| |||||    
316599 aaatttcagttta 316587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295775 times since January 2019
Visitors: 3016