View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398-Insertion-3 (Length: 1005)

Name: NF4398-Insertion-3
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398-Insertion-3
NF4398-Insertion-3
[»] chr1 (1 HSPs)
chr1 (8-1005)||(45512242-45513248)
[»] chr2 (1 HSPs)
chr2 (494-625)||(22848797-22848928)


Alignment Details
Target: chr1 (Bit Score: 939; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 939; E-Value: 0
Query Start/End: Original strand, 8 - 1005
Target Start/End: Complemental strand, 45513248 - 45512242
Alignment:
8 aaagcccattgtaagaaaggtcaagaagggtaagtttctcaaagtgactgaaccataatggaatagaagtgaaattatttccagaaaggtagagtgattc 107  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
45513248 aaagcccattataagaaaggtcaagaagggtaagtttctcaaagtgaccgaaccataatggaatagaagtgaaattatttccagaaaggtagagtgattc 45513149  T
108 aatggaagtcatgtttccaaaagactcaggaatcggaccatgaagctcatttgatgagagatcaagatagataagagatgtcatgttttggaaagcataa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45513148 aatggaagtcatgtttccaaaagactcaggaatcggaccatgaagctcatttgatgagagatcaagatagataagagatgtcatgttttggaaagcataa 45513049  T
208 cgaggaatgagtgaattgtcaactctacatccagacagtgaaagatttaataaagaaggaagtgtattgagtacctggaacaagttgcgcttgtcattga 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
45513048 cgaggaatgagtgaattgtcaactctacatccagacagtgaaagatttaataaagaaggaagtgtattgagtacctggaacaagttgcgcgtgtcattga 45512949  T
308 gacgaataccactcaagtcaaggtgtttgagtgagtgaaggtttgaaatccaactggtgtcgtcatccatttgtaattctctctcttcaaattgcgtaag 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
45512948 gacgaataccactcaagtcaaggtgtttgagtgagtgaaggtttgaaatccaactggtgccgtcatccatttgtaattctctctcttcaaattgcgtaag 45512849  T
408 gtaatagtaattgaagctgagatcaaggaattgtaggttcttgagatttctgagactgttgggaatcctcccgctaagacgagcatgagacagagagaga 507  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45512848 gtaatagtaattgaagctgagatcaaggaatcgtaggttcttgagatttctgagactgttgggaatcctcccgctaagacgagcatgagacagagagaga 45512749  T
508 tactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttctagacaagtccaaataagtcaagtgttccaattgcaaca 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
45512748 tactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttccagacaagtccaaataagtcaagtgttccaattgcaaca 45512649  T
608 aagatgagctcacatttggagcaactattggtgaacaaggcatgtaatcgtcc---------aaatagtagtgaccaaaatgttcttcttctcgcgacca 698  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||    
45512648 aagatgagctcacatttggagcaactattggtgaacaaggcatgtaatcgtccaaattgtacaaatagtagtgaccaaaatgttcttcttctcgcgacca 45512549  T
699 agatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttc 798  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45512548 aaatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttc 45512449  T
799 catgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacac 898  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45512448 catgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacac 45512349  T
899 acaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatggtttctatctctgtttctaatgaaataattgaatg 998  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
45512348 acaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattgaatg 45512249  T
999 atggttt 1005  Q
    |||||||    
45512248 atggttt 45512242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 80; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 494 - 625
Target Start/End: Original strand, 22848797 - 22848928
Alignment:
494 gagacagagagagatactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttctagacaagtccaaataagtcaagtg 593  Q
    |||| ||||||||||||||||| |||||||||||||| | |||||||||||||||||||  | |||||| ||||| || ||||||||||||||||||||     
22848797 gagagagagagagatactcaagacgtcccatggaacctacgaacataggaattggactcaaattgaaatcatttccagtcaagtccaaataagtcaagta 22848896  T
594 ttccaattgcaacaaagatgagctcacatttg 625  Q
    |||||| ||||||||||||||||||| |||||    
22848897 ttccaagtgcaacaaagatgagctcagatttg 22848928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125048 times since January 2019
Visitors: 1417