View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398-Insertion-3 (Length: 1005)

Name: NF4398-Insertion-3
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398-Insertion-3
[»] chr1 (1 HSPs)
chr1 (8-1005)||(45512242-45513248)
[»] chr2 (1 HSPs)
chr2 (494-625)||(22848797-22848928)

Alignment Details
Target: chr1 (Bit Score: 939; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 939; E-Value: 0
Query Start/End: Original strand, 8 - 1005
Target Start/End: Complemental strand, 45513248 - 45512242
8 aaagcccattgtaagaaaggtcaagaagggtaagtttctcaaagtgactgaaccataatggaatagaagtgaaattatttccagaaaggtagagtgattc 107  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
45513248 aaagcccattataagaaaggtcaagaagggtaagtttctcaaagtgaccgaaccataatggaatagaagtgaaattatttccagaaaggtagagtgattc 45513149  T
108 aatggaagtcatgtttccaaaagactcaggaatcggaccatgaagctcatttgatgagagatcaagatagataagagatgtcatgttttggaaagcataa 207  Q
45513148 aatggaagtcatgtttccaaaagactcaggaatcggaccatgaagctcatttgatgagagatcaagatagataagagatgtcatgttttggaaagcataa 45513049  T
208 cgaggaatgagtgaattgtcaactctacatccagacagtgaaagatttaataaagaaggaagtgtattgagtacctggaacaagttgcgcttgtcattga 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
45513048 cgaggaatgagtgaattgtcaactctacatccagacagtgaaagatttaataaagaaggaagtgtattgagtacctggaacaagttgcgcgtgtcattga 45512949  T
308 gacgaataccactcaagtcaaggtgtttgagtgagtgaaggtttgaaatccaactggtgtcgtcatccatttgtaattctctctcttcaaattgcgtaag 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
45512948 gacgaataccactcaagtcaaggtgtttgagtgagtgaaggtttgaaatccaactggtgccgtcatccatttgtaattctctctcttcaaattgcgtaag 45512849  T
408 gtaatagtaattgaagctgagatcaaggaattgtaggttcttgagatttctgagactgttgggaatcctcccgctaagacgagcatgagacagagagaga 507  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45512848 gtaatagtaattgaagctgagatcaaggaatcgtaggttcttgagatttctgagactgttgggaatcctcccgctaagacgagcatgagacagagagaga 45512749  T
508 tactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttctagacaagtccaaataagtcaagtgttccaattgcaaca 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
45512748 tactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttccagacaagtccaaataagtcaagtgttccaattgcaaca 45512649  T
608 aagatgagctcacatttggagcaactattggtgaacaaggcatgtaatcgtcc---------aaatagtagtgaccaaaatgttcttcttctcgcgacca 698  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||    
45512648 aagatgagctcacatttggagcaactattggtgaacaaggcatgtaatcgtccaaattgtacaaatagtagtgaccaaaatgttcttcttctcgcgacca 45512549  T
699 agatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttc 798  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45512548 aaatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttc 45512449  T
799 catgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacac 898  Q
45512448 catgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacac 45512349  T
899 acaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatggtttctatctctgtttctaatgaaataattgaatg 998  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
45512348 acaagcatatttgtgcaatttcaatcaacaccaaaagtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattgaatg 45512249  T
999 atggttt 1005  Q
45512248 atggttt 45512242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 80; Significance: 5e-37; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 494 - 625
Target Start/End: Original strand, 22848797 - 22848928
494 gagacagagagagatactcaaggcgtcccatggaacccaagaacataggaattggactcccactgaaattatttctagacaagtccaaataagtcaagtg 593  Q
    |||| ||||||||||||||||| |||||||||||||| | |||||||||||||||||||  | |||||| ||||| || ||||||||||||||||||||     
22848797 gagagagagagagatactcaagacgtcccatggaacctacgaacataggaattggactcaaattgaaatcatttccagtcaagtccaaataagtcaagta 22848896  T
594 ttccaattgcaacaaagatgagctcacatttg 625  Q
    |||||| ||||||||||||||||||| |||||    
22848897 ttccaagtgcaacaaagatgagctcagatttg 22848928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 14392 times since January 2019
Visitors: 567