View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_high_11 (Length: 257)

Name: NF4398_high_11
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398_high_11
[»] chr6 (1 HSPs)
chr6 (1-257)||(34563256-34563512)

Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 34563256 - 34563512
1 cattaatatttaatattgcatgtctaaagaagcatattaagtaattcaacaatttgtaccatattatctctttatcaaccaaaaatctccatcttcgctt 100  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
34563256 cattaatatttaatattgcatgcctaaagaagcatattgagtaattcaacaatttgtaccatattatctctttatcaaccaaaaacctccatcttcgctt 34563355  T
101 agcctctaacacaatattaaacatatcaagattttttacaactctcccaccactattttttgtttgacacattcgatcccaactaatccaacaaatgact 200  Q
34563356 agcctctaacacaatattaaacatatcaagattttttacaactctcccaccactattttttgtttgacacattcgatcccaactaatccaacaaatgact 34563455  T
201 ttcatttaggagaatggatgtaaagtcatagaaaataaaacctctaacccaatctat 257  Q
34563456 ttcatttaggagaatggatgtaaagtcatagaaaataaaacctctaacccaatctat 34563512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 116188 times since January 2019
Visitors: 1395