View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_high_14 (Length: 209)

Name: NF4398_high_14
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398_high_14
NF4398_high_14
[»] chr3 (2 HSPs)
chr3 (1-193)||(32376223-32376413)
chr3 (1-188)||(32364541-32364712)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 32376413 - 32376223
Alignment:
1 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatttnnnnnnnnnnnnnnnttctttttacaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |               |||||||||||||    
32376413 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatcttgtgtgtgt------ttctttttacaag 32376320  T
101 aaaatcatatgaaatacatattaaaatgacatatatgaac----ttagttttacaatcttaaaatatgtttcttctactgaaactctttgagggtag 193  Q
    ||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| ||||||||||||||||||||||||||    
32376319 aaaatcatatgaaatacatattaaaatgacatatatgaacttaattagttttacaatcttaaaatatgttccttctactgaaactctttgagggtag 32376223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 32364712 - 32364541
Alignment:
1 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatttnnnnnnnnnnnnnnnttctttttacaag 100  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |               |||||||||||||    
32364712 cggattatagttattgagtgagcatcaccttttctatttaattgcttacaagtctgtgtgagtaggaaatct------tgtgtgtatttctttttacaag 32364619  T
101 aaaatcatatgaaatacatattaaaatgacatatatgaacttagttttacaatcttaaaatatgtttcttctactgaaactctttgag 188  Q
    ||||||||||||||||||| ||| |||          |||||||||||||||||||||  |||||| |||||||||||||||||||||    
32364618 aaaatcatatgaaatacatgttagaat----------aacttagttttacaatcttaatgtatgttccttctactgaaactctttgag 32364541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111542 times since January 2019
Visitors: 1375