View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_high_2 (Length: 559)

Name: NF4398_high_2
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398_high_2
NF4398_high_2
[»] chr7 (1 HSPs)
chr7 (7-542)||(41920638-41921174)
[»] chr1 (4 HSPs)
chr1 (152-356)||(26829762-26829966)
chr1 (151-297)||(26782932-26783078)
chr1 (151-357)||(26789245-26789451)
chr1 (172-295)||(26816137-26816260)
[»] chr2 (1 HSPs)
chr2 (251-297)||(2301218-2301264)


Alignment Details
Target: chr7 (Bit Score: 509; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 509; E-Value: 0
Query Start/End: Original strand, 7 - 542
Target Start/End: Original strand, 41920638 - 41921174
Alignment:
7 tcgaaaaatatgtatttaaatgtataccttttttaactactactgtgtaacatgctgtacaaatacataagccaa-tttccctttaaatacaagaaactt 105  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
41920638 tcgaataatatgtatttaaatgtatacctttttcaactactactgtgtaacatgctgtacaaatacataagccaaatttccctttaaatacaagaaactt 41920737  T
106 gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41920738 gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct 41920837  T
206 gcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagca 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41920838 gcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagca 41920937  T
306 gggactaaagcactcaagaagcctcgattcaggattgaagacaggtataaatcagtactattgtcttagttatttggtagcattcaactagttttttaat 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
41920938 gggactaaagcactcaagaagcctcgattcaggattgaagacaggtataaattagtactattgtcttagttatttgatagcattcaactagttttttaat 41921037  T
406 catgattgtgtcacaatctttaatatttagagcatcgcaatctaagcaactgatgcgaccaatagtaaattgtggtcgcatagatgttgcagaaactttt 505  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41921038 catgattgtgtcacaatctttaatatttagagcatcgcaatttaagcaactgatgcgaccaatagtaaattgtggtcgcatagatgttgcagaaactttt 41921137  T
506 atgtcgtgactcggatggcagttgcaaaccactttta 542  Q
    |||||||||||||||||||||||||||||||||||||    
41921138 atgtcgtgactcggatggcagttgcaaaccactttta 41921174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 101; Significance: 8e-50; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 152 - 356
Target Start/End: Complemental strand, 26829966 - 26829762
Alignment:
152 caggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcga 251  Q
    ||||||| |||||||||| |||||||||||| |||| ||||||  ||||||||| ||| || ||||||||||  ||||||||||||| ||||||||| ||    
26829966 caggtcattccatttacttgtcttttggattttattcgagaataccatgtctcttcatcgaacaaaggcaacgattattggtctactagaggctagtaga 26829867  T
252 gtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagcagggactaaagcactcaagaagcctcgattcaggattgaagacaggt 351  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||| ||||||  |   ||||| |||||| |||| |||||| ||||||| ||||||||    
26829866 gtgaatgaatggattgtcactgaaaaacttggagatgctttcaagggtaaagctagtggtaaaggactcaaaaagcttcgatttaggattggagacaggt 26829767  T
352 ataaa 356  Q
    |||||    
26829766 ataaa 26829762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 151 - 297
Target Start/End: Complemental strand, 26783078 - 26782932
Alignment:
151 tcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcg 250  Q
    |||||||| | |||||| | || ||||||||||| |||||||||  ||||||| |  || |||||||||||||  |||||||| |||| ||| ||||| |    
26783078 tcaggtcattgcatttagttgtattttggattctctttgagaataccatgtctttaaatcgagcaaaggcaacaattattggtatactagagactagtag 26782979  T
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaagg 297  Q
    ||||||||||||||||||||| || ||||||||| ||||||| ||||    
26782978 agtgaatgaatggattgtcacagaaaaacttggaaatgctcttaagg 26782932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 151 - 357
Target Start/End: Complemental strand, 26789451 - 26789245
Alignment:
151 tcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcg 250  Q
    |||||||| || ||||| |  |||||||| |||| ||||| |||  |||  |||| ||| || |||| |||||  |||||||||| || ||| ||||| |    
26789451 tcaggtcattctatttagttatcttttgggttctctttgaaaataccatagctctacatcgaacaaaagcaacaattattggtctgctagagactagtag 26789352  T
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagcagggactaaagcactcaagaagcctcgattcaggattgaagacagg 350  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| |||||  ||   ||||| |||||| |||| |||||| |  |||| |||||||    
26789351 agtgaatgaatggattgtcactgaaaaacttggagatgctctcaagggtaaagatggtggtaaagaactcaaaaagcttcgatttaaaattgtagacagg 26789252  T
351 tataaat 357  Q
    || ||||    
26789251 taaaaat 26789245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 172 - 295
Target Start/End: Complemental strand, 26816260 - 26816137
Alignment:
172 tcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcac 271  Q
    |||||||| |||| ||||| |||  |||  |||| ||| || |||| |||||  ||||||||||||| ||| ||||| ||||||||||||||||||||||    
26816260 tcttttgggttctctttgaaaataccatagctctacatcgaacaaaagcaacaattattggtctactagagactagtagagtgaatgaatggattgtcac 26816161  T
272 tgagaaacttggagatgctctcaa 295  Q
    ||| ||||||||||||||||||||    
26816160 tgaaaaacttggagatgctctcaa 26816137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 251 - 297
Target Start/End: Original strand, 2301218 - 2301264
Alignment:
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaagg 297  Q
    |||||||||||||||||||||| | ||||||||| ||||||| ||||    
2301218 agtgaatgaatggattgtcactaaaaaacttggaaatgctcttaagg 2301264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 115677 times since January 2019
Visitors: 1394