View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_high_9 (Length: 285)

Name: NF4398_high_9
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398_high_9
[»] chr5 (2 HSPs)
chr5 (6-285)||(9853826-9854105)
chr5 (6-285)||(9819875-9820154)
[»] chr7 (1 HSPs)
chr7 (21-285)||(44870755-44871037)
[»] chr3 (3 HSPs)
chr3 (24-285)||(47523413-47523692)
chr3 (138-285)||(47528761-47528908)
chr3 (14-140)||(47528924-47529050)
[»] chr6 (4 HSPs)
chr6 (176-279)||(21062100-21062203)
chr6 (176-279)||(21081493-21081596)
chr6 (156-285)||(21080663-21080790)
chr6 (241-285)||(21061353-21061397)

Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 285
Target Start/End: Complemental strand, 9854105 - 9853826
6 actccttttcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaa 105  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||| |||    
9854105 actccttgtcatcaacactactcacattcttcaccaatgtccatgttaaattatctgcaaccttaattggttttcctaacaacttctttagacataagaa 9854006  T
106 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||    
9854005 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctacagcctttacgcatccaaagtgatatttttgctcacattga 9853906  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
9853905 acacaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 9853826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 6 - 285
Target Start/End: Original strand, 9819875 - 9820154
6 actccttttcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaa 105  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||| |||    
9819875 actccttgtcatcaacactactcacattcttcaccaatgtccatgttaaattatctgcaaccttaattggttttcctaacaacttctttagacataagaa 9819974  T
106 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||    
9819975 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctacagcctttacacatccaaagtgatatttttgctcacattga 9820074  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
9820075 acacaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 9820154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 21 - 285
Target Start/End: Original strand, 44870755 - 44871037
21 cactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcccacaaac 120  Q
    ||||||| |||||||||| |||||||||  ||| ||||||||||||||| |||||||| ||  | | |||||||||||||| ||||||||||||||||||    
44870755 cactactcacattcttcaacaatgtccaatttatattatctgcaaccttaattggtttccccaatagcttctttagacataagaacatgttcccacaaac 44870854  T
121 cacactgcaaaaccaat------------------tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacat 202  Q
     ||||||||||||||||                  ||||  ||||| || || ||| || | ||| |||||| |||||||||||| ||||||||||||||    
44870855 tacactgcaaaaccaattcttctttttaatattgctctctgtgtgactagatccaaatcttgtagtctttacacacccaaagtgaaatttttgctcacat 44870954  T
203 tgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || || || ||||||| |||||| || |||  ||||  ||||||||||||||||||||||||||| |||||||||||||||||    
44870955 tgtacacatacaagaaaattgttttcattgccatctgcacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 44871037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 24 - 285
Target Start/End: Complemental strand, 47523692 - 47523413
24 tacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcccacaaaccac 123  Q
    |||| ||||||||||  |||||||| ||||||||| |||||||  | |||||||| |||||||||||||||||||||| ||||||||| |||||||| ||    
47523692 tactcacattcttcaataatgtccaagttagattagctgcaactgttattggtttccctgacaacttctttagacataagaacatgttaccacaaactac 47523593  T
124 actgcaaaaccaat------------------tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||                  |||| |||||| |  || ||| ||||| ||||||||| |||||||| ||| | |||||  ||||||||    
47523592 actgcaaaaccaattcttcttttcaccattgctctcaatgtgacttgatccaagtcctaaagcctttacacacccaaaatgaaacttttgtgcacattga 47523493  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||| | || |||  ||||  ||||||||| ||||||||||||||||| |||||||||||||||||    
47523492 acacaaacaagaatattgctgtcattgccatctgcacattcttgcttgcatttgggtcgatagcatattttgcaacaaca 47523413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 138 - 285
Target Start/End: Complemental strand, 47528908 - 47528761
138 tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatc 237  Q
    ||||||||||| || |||||  |||| | |||||||| |||||||||||| |||| |||||||||||||| |||||||||||||||||||| |||  |||    
47528908 tctccatgtgactagattcatatcctgttgcctttacacacccaaagtgaaatttctgctcacattgaacacaaacaagaatattgttatcattggtatc 47528809  T
238 tttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    | ||||||||||||| ||||| |||||| |||||||||||||||||||    
47528808 tgtacattcttgtttacatttaggtcgacaacatattttgcaacaaca 47528761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 140
Target Start/End: Complemental strand, 47529050 - 47528924
14 tcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcc 113  Q
    |||||| ||||| | |||||||||| || |||||| |||||||| ||||||||||| |||||||| |   | | |||||||||||||| |||| |||||     
47529050 tcatcatcactattcacattcttcaacagtgtccaagttagattgtctgcaaccttaattggtttccacaatagcttctttagacatatgaacctgttca 47528951  T
114 cacaaaccacactgcaaaaccaattct 140  Q
    | ||||| | | |||||||||||||||    
47528950 cgcaaactatattgcaaaaccaattct 47528924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 4)
Name: chr6

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 21062203 - 21062100
176 cacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattt 275  Q
    |||||||| ||| ||||||||||||||||||| ||  |||||||||||||||| ||   || |  ||| ||||||||||| || ||| ||||||||||||    
21062203 cacccaaattgaaatttttgctcacattgaacacacgcaagaatattgttatcattaccatttgcacactcttgtttgcactttggttgataacatattt 21062104  T
276 tgca 279  Q
21062103 tgca 21062100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 21081596 - 21081493
176 cacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattt 275  Q
    |||||||| ||| ||||||||||||||||||| ||  |||||||||||||||| ||   || |  ||| ||||||||||| || ||| ||||||||||||    
21081596 cacccaaattgaaatttttgctcacattgaacacacgcaagaatattgttatcattaccatttgcacactcttgtttgcactttggttgataacatattt 21081497  T
276 tgca 279  Q
21081496 tgca 21081493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 285
Target Start/End: Original strand, 21080663 - 21080790
156 caattcctatagcctttacgcacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgca 255  Q
    |||||| |||||||||||| |||||||||||| | |||| | |||||||| | ||||||| ||| ||||| |  ||   || |  ||||||| |||| ||    
21080663 caattcatatagcctttacacacccaaagtgaaaatttt-cacacattgatcacaaacaa-aatgttgttttgatttccatatgcacattctggttttca 21080760  T
256 tttgggtcgataacatattttgcaacaaca 285  Q
    ||| |||||||| |||||||||||||||||    
21080761 tttaggtcgatagcatattttgcaacaaca 21080790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 285
Target Start/End: Original strand, 21061353 - 21061397
241 acattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    ||||||| |||| ||||| |||||||| |||||||||||||||||    
21061353 acattctggttttcatttaggtcgatagcatattttgcaacaaca 21061397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111481 times since January 2019
Visitors: 1375