View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_low_10 (Length: 285)

Name: NF4398_low_10
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398_low_10
NF4398_low_10
[»] chr5 (2 HSPs)
chr5 (6-285)||(9853826-9854105)
chr5 (6-285)||(9819875-9820154)
[»] chr7 (1 HSPs)
chr7 (21-285)||(44870755-44871037)
[»] chr3 (3 HSPs)
chr3 (24-285)||(47523413-47523692)
chr3 (138-285)||(47528761-47528908)
chr3 (14-140)||(47528924-47529050)
[»] chr6 (4 HSPs)
chr6 (176-279)||(21062100-21062203)
chr6 (176-279)||(21081493-21081596)
chr6 (156-285)||(21080663-21080790)
chr6 (241-285)||(21061353-21061397)


Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 285
Target Start/End: Complemental strand, 9854105 - 9853826
Alignment:
6 actccttttcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaa 105  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||| |||    
9854105 actccttgtcatcaacactactcacattcttcaccaatgtccatgttaaattatctgcaaccttaattggttttcctaacaacttctttagacataagaa 9854006  T
106 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||    
9854005 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctacagcctttacgcatccaaagtgatatttttgctcacattga 9853906  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
9853905 acacaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 9853826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 6 - 285
Target Start/End: Original strand, 9819875 - 9820154
Alignment:
6 actccttttcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaa 105  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||| |||    
9819875 actccttgtcatcaacactactcacattcttcaccaatgtccatgttaaattatctgcaaccttaattggttttcctaacaacttctttagacataagaa 9819974  T
106 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||    
9819975 catgttcccacaaaccacactgcaaaaccaattctccatgtgattaaattcaattcctacagcctttacacatccaaagtgatatttttgctcacattga 9820074  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
9820075 acacaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 9820154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 21 - 285
Target Start/End: Original strand, 44870755 - 44871037
Alignment:
21 cactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcccacaaac 120  Q
    ||||||| |||||||||| |||||||||  ||| ||||||||||||||| |||||||| ||  | | |||||||||||||| ||||||||||||||||||    
44870755 cactactcacattcttcaacaatgtccaatttatattatctgcaaccttaattggtttccccaatagcttctttagacataagaacatgttcccacaaac 44870854  T
121 cacactgcaaaaccaat------------------tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacat 202  Q
     ||||||||||||||||                  ||||  ||||| || || ||| || | ||| |||||| |||||||||||| ||||||||||||||    
44870855 tacactgcaaaaccaattcttctttttaatattgctctctgtgtgactagatccaaatcttgtagtctttacacacccaaagtgaaatttttgctcacat 44870954  T
203 tgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || || || ||||||| |||||| || |||  ||||  ||||||||||||||||||||||||||| |||||||||||||||||    
44870955 tgtacacatacaagaaaattgttttcattgccatctgcacattcttgtttgcatttgggtcgatagcatattttgcaacaaca 44871037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 24 - 285
Target Start/End: Complemental strand, 47523692 - 47523413
Alignment:
24 tacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcccacaaaccac 123  Q
    |||| ||||||||||  |||||||| ||||||||| |||||||  | |||||||| |||||||||||||||||||||| ||||||||| |||||||| ||    
47523692 tactcacattcttcaataatgtccaagttagattagctgcaactgttattggtttccctgacaacttctttagacataagaacatgttaccacaaactac 47523593  T
124 actgcaaaaccaat------------------tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattga 205  Q
    ||||||||||||||                  |||| |||||| |  || ||| ||||| ||||||||| |||||||| ||| | |||||  ||||||||    
47523592 actgcaaaaccaattcttcttttcaccattgctctcaatgtgacttgatccaagtcctaaagcctttacacacccaaaatgaaacttttgtgcacattga 47523493  T
206 acgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    || ||||||||||||||| | || |||  ||||  ||||||||| ||||||||||||||||| |||||||||||||||||    
47523492 acacaaacaagaatattgctgtcattgccatctgcacattcttgcttgcatttgggtcgatagcatattttgcaacaaca 47523413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 138 - 285
Target Start/End: Complemental strand, 47528908 - 47528761
Alignment:
138 tctccatgtgattaaattcaattcctatagcctttacgcacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatc 237  Q
    ||||||||||| || |||||  |||| | |||||||| |||||||||||| |||| |||||||||||||| |||||||||||||||||||| |||  |||    
47528908 tctccatgtgactagattcatatcctgttgcctttacacacccaaagtgaaatttctgctcacattgaacacaaacaagaatattgttatcattggtatc 47528809  T
238 tttacattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    | ||||||||||||| ||||| |||||| |||||||||||||||||||    
47528808 tgtacattcttgtttacatttaggtcgacaacatattttgcaacaaca 47528761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 140
Target Start/End: Complemental strand, 47529050 - 47528924
Alignment:
14 tcatcaacactacttacattcttcaccaatgtccatgttagattatctgcaaccttgattggttttcctgacaacttctttagacatacgaacatgttcc 113  Q
    |||||| ||||| | |||||||||| || |||||| |||||||| ||||||||||| |||||||| |   | | |||||||||||||| |||| |||||     
47529050 tcatcatcactattcacattcttcaacagtgtccaagttagattgtctgcaaccttaattggtttccacaatagcttctttagacatatgaacctgttca 47528951  T
114 cacaaaccacactgcaaaaccaattct 140  Q
    | ||||| | | |||||||||||||||    
47528950 cgcaaactatattgcaaaaccaattct 47528924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 21062203 - 21062100
Alignment:
176 cacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattt 275  Q
    |||||||| ||| ||||||||||||||||||| ||  |||||||||||||||| ||   || |  ||| ||||||||||| || ||| ||||||||||||    
21062203 cacccaaattgaaatttttgctcacattgaacacacgcaagaatattgttatcattaccatttgcacactcttgtttgcactttggttgataacatattt 21062104  T
276 tgca 279  Q
    ||||    
21062103 tgca 21062100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 21081596 - 21081493
Alignment:
176 cacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgcatttgggtcgataacatattt 275  Q
    |||||||| ||| ||||||||||||||||||| ||  |||||||||||||||| ||   || |  ||| ||||||||||| || ||| ||||||||||||    
21081596 cacccaaattgaaatttttgctcacattgaacacacgcaagaatattgttatcattaccatttgcacactcttgtttgcactttggttgataacatattt 21081497  T
276 tgca 279  Q
    ||||    
21081496 tgca 21081493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 285
Target Start/End: Original strand, 21080663 - 21080790
Alignment:
156 caattcctatagcctttacgcacccaaagtgatatttttgctcacattgaacgcaaacaagaatattgttatccttgtgatctttacattcttgtttgca 255  Q
    |||||| |||||||||||| |||||||||||| | |||| | |||||||| | ||||||| ||| ||||| |  ||   || |  ||||||| |||| ||    
21080663 caattcatatagcctttacacacccaaagtgaaaatttt-cacacattgatcacaaacaa-aatgttgttttgatttccatatgcacattctggttttca 21080760  T
256 tttgggtcgataacatattttgcaacaaca 285  Q
    ||| |||||||| |||||||||||||||||    
21080761 tttaggtcgatagcatattttgcaacaaca 21080790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 285
Target Start/End: Original strand, 21061353 - 21061397
Alignment:
241 acattcttgtttgcatttgggtcgataacatattttgcaacaaca 285  Q
    ||||||| |||| ||||| |||||||| |||||||||||||||||    
21061353 acattctggttttcatttaggtcgatagcatattttgcaacaaca 21061397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37779 times since January 2019
Visitors: 1597