View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_low_12 (Length: 257)

Name: NF4398_low_12
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4398_low_12
NF4398_low_12
[»] chr6 (1 HSPs)
chr6 (1-257)||(34563256-34563512)


Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 34563256 - 34563512
Alignment:
1 cattaatatttaatattgcatgtctaaagaagcatattaagtaattcaacaatttgtaccatattatctctttatcaaccaaaaatctccatcttcgctt 100  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
34563256 cattaatatttaatattgcatgcctaaagaagcatattgagtaattcaacaatttgtaccatattatctctttatcaaccaaaaacctccatcttcgctt 34563355  T
101 agcctctaacacaatattaaacatatcaagattttttacaactctcccaccactattttttgtttgacacattcgatcccaactaatccaacaaatgact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34563356 agcctctaacacaatattaaacatatcaagattttttacaactctcccaccactattttttgtttgacacattcgatcccaactaatccaacaaatgact 34563455  T
201 ttcatttaggagaatggatgtaaagtcatagaaaataaaacctctaacccaatctat 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34563456 ttcatttaggagaatggatgtaaagtcatagaaaataaaacctctaacccaatctat 34563512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295831 times since January 2019
Visitors: 3016