View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_low_15 (Length: 209)

Name: NF4398_low_15
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398_low_15
[»] chr3 (2 HSPs)
chr3 (1-193)||(32376223-32376413)
chr3 (1-188)||(32364541-32364712)

Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 32376413 - 32376223
1 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatttnnnnnnnnnnnnnnnttctttttacaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |               |||||||||||||    
32376413 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatcttgtgtgtgt------ttctttttacaag 32376320  T
101 aaaatcatatgaaatacatattaaaatgacatatatgaac----ttagttttacaatcttaaaatatgtttcttctactgaaactctttgagggtag 193  Q
    ||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| ||||||||||||||||||||||||||    
32376319 aaaatcatatgaaatacatattaaaatgacatatatgaacttaattagttttacaatcttaaaatatgttccttctactgaaactctttgagggtag 32376223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 32364712 - 32364541
1 cggattatagttattgagtgagcatcactttttctatttaattgcttacaagtctgtgtgagtaggaaatttnnnnnnnnnnnnnnnttctttttacaag 100  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |               |||||||||||||    
32364712 cggattatagttattgagtgagcatcaccttttctatttaattgcttacaagtctgtgtgagtaggaaatct------tgtgtgtatttctttttacaag 32364619  T
101 aaaatcatatgaaatacatattaaaatgacatatatgaacttagttttacaatcttaaaatatgtttcttctactgaaactctttgag 188  Q
    ||||||||||||||||||| ||| |||          |||||||||||||||||||||  |||||| |||||||||||||||||||||    
32364618 aaaatcatatgaaatacatgttagaat----------aacttagttttacaatcttaatgtatgttccttctactgaaactctttgag 32364541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176070 times since January 2019
Visitors: 2680