View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4398_low_2 (Length: 559)

Name: NF4398_low_2
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4398_low_2
[»] chr7 (1 HSPs)
chr7 (7-542)||(41920638-41921174)
[»] chr1 (4 HSPs)
chr1 (152-356)||(26829762-26829966)
chr1 (151-297)||(26782932-26783078)
chr1 (151-357)||(26789245-26789451)
chr1 (172-295)||(26816137-26816260)
[»] chr2 (1 HSPs)
chr2 (251-297)||(2301218-2301264)

Alignment Details
Target: chr7 (Bit Score: 509; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 509; E-Value: 0
Query Start/End: Original strand, 7 - 542
Target Start/End: Original strand, 41920638 - 41921174
7 tcgaaaaatatgtatttaaatgtataccttttttaactactactgtgtaacatgctgtacaaatacataagccaa-tttccctttaaatacaagaaactt 105  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
41920638 tcgaataatatgtatttaaatgtatacctttttcaactactactgtgtaacatgctgtacaaatacataagccaaatttccctttaaatacaagaaactt 41920737  T
106 gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct 205  Q
41920738 gttatgcaagtaaaactttgttaacttgattgtgttttctacatgtcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctct 41920837  T
206 gcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagca 305  Q
41920838 gcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagca 41920937  T
306 gggactaaagcactcaagaagcctcgattcaggattgaagacaggtataaatcagtactattgtcttagttatttggtagcattcaactagttttttaat 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
41920938 gggactaaagcactcaagaagcctcgattcaggattgaagacaggtataaattagtactattgtcttagttatttgatagcattcaactagttttttaat 41921037  T
406 catgattgtgtcacaatctttaatatttagagcatcgcaatctaagcaactgatgcgaccaatagtaaattgtggtcgcatagatgttgcagaaactttt 505  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41921038 catgattgtgtcacaatctttaatatttagagcatcgcaatttaagcaactgatgcgaccaatagtaaattgtggtcgcatagatgttgcagaaactttt 41921137  T
506 atgtcgtgactcggatggcagttgcaaaccactttta 542  Q
41921138 atgtcgtgactcggatggcagttgcaaaccactttta 41921174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 101; Significance: 8e-50; HSPs: 4)
Name: chr1

Target: chr1; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 152 - 356
Target Start/End: Complemental strand, 26829966 - 26829762
152 caggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcga 251  Q
    ||||||| |||||||||| |||||||||||| |||| ||||||  ||||||||| ||| || ||||||||||  ||||||||||||| ||||||||| ||    
26829966 caggtcattccatttacttgtcttttggattttattcgagaataccatgtctcttcatcgaacaaaggcaacgattattggtctactagaggctagtaga 26829867  T
252 gtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagcagggactaaagcactcaagaagcctcgattcaggattgaagacaggt 351  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||| ||||||  |   ||||| |||||| |||| |||||| ||||||| ||||||||    
26829866 gtgaatgaatggattgtcactgaaaaacttggagatgctttcaagggtaaagctagtggtaaaggactcaaaaagcttcgatttaggattggagacaggt 26829767  T
352 ataaa 356  Q
26829766 ataaa 26829762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 151 - 297
Target Start/End: Complemental strand, 26783078 - 26782932
151 tcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcg 250  Q
    |||||||| | |||||| | || ||||||||||| |||||||||  ||||||| |  || |||||||||||||  |||||||| |||| ||| ||||| |    
26783078 tcaggtcattgcatttagttgtattttggattctctttgagaataccatgtctttaaatcgagcaaaggcaacaattattggtatactagagactagtag 26782979  T
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaagg 297  Q
    ||||||||||||||||||||| || ||||||||| ||||||| ||||    
26782978 agtgaatgaatggattgtcacagaaaaacttggaaatgctcttaagg 26782932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 151 - 357
Target Start/End: Complemental strand, 26789451 - 26789245
151 tcaggtcactccatttactcgtcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcg 250  Q
    |||||||| || ||||| |  |||||||| |||| ||||| |||  |||  |||| ||| || |||| |||||  |||||||||| || ||| ||||| |    
26789451 tcaggtcattctatttagttatcttttgggttctctttgaaaataccatagctctacatcgaacaaaagcaacaattattggtctgctagagactagtag 26789352  T
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaaggctaaagcagggactaaagcactcaagaagcctcgattcaggattgaagacagg 350  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| |||||  ||   ||||| |||||| |||| |||||| |  |||| |||||||    
26789351 agtgaatgaatggattgtcactgaaaaacttggagatgctctcaagggtaaagatggtggtaaagaactcaaaaagcttcgatttaaaattgtagacagg 26789252  T
351 tataaat 357  Q
    || ||||    
26789251 taaaaat 26789245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 172 - 295
Target Start/End: Complemental strand, 26816260 - 26816137
172 tcttttggattctatttgagaatgtcatgtctctgcatagagcaaaggcaactgttattggtctactggaggctagtcgagtgaatgaatggattgtcac 271  Q
    |||||||| |||| ||||| |||  |||  |||| ||| || |||| |||||  ||||||||||||| ||| ||||| ||||||||||||||||||||||    
26816260 tcttttgggttctctttgaaaataccatagctctacatcgaacaaaagcaacaattattggtctactagagactagtagagtgaatgaatggattgtcac 26816161  T
272 tgagaaacttggagatgctctcaa 295  Q
    ||| ||||||||||||||||||||    
26816160 tgaaaaacttggagatgctctcaa 26816137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 251 - 297
Target Start/End: Original strand, 2301218 - 2301264
251 agtgaatgaatggattgtcactgagaaacttggagatgctctcaagg 297  Q
    |||||||||||||||||||||| | ||||||||| ||||||| ||||    
2301218 agtgaatgaatggattgtcactaaaaaacttggaaatgctcttaagg 2301264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295829 times since January 2019
Visitors: 3016