View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-1 (Length: 1088)

Name: NF4429-Insertion-1
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-1
[»] chr3 (1 HSPs)
chr3 (9-1088)||(33530990-33532074)
[»] chr5 (2 HSPs)
chr5 (700-945)||(26209619-26209864)
chr5 (209-353)||(26209083-26209227)

Alignment Details
Target: chr3 (Bit Score: 939; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 939; E-Value: 0
Query Start/End: Original strand, 9 - 1088
Target Start/End: Original strand, 33530990 - 33532074
9 caaggtcaaattttggcattttctcgtaaattgtatatgcttcttgctgtcttaggagcttcaacaaggcttctgtttgtaaagcatagacctggtagac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
33530990 caaggtcaaattttggcattttctcgtaaattgtatatgcttcttgctgtcttaggagcttcaacaaggcttcagtttgtaaagcatagacctggtagac 33531089  T
109 ataaccannnnnnnaatcagcataagagggttattggccaatgagttgagtaacatatgattnnnnnnnntgtaggagtgcctaaaataaaacatttaac 208  Q
    |||||||       ||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||    
33531090 ataaccatttttttaatcagcataagagggttattggccaatgagttgagtaacatatgattaaaaaaaatgtaggagtgcctaaaataaaacatttaac 33531189  T
209 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 308  Q
33531190 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 33531289  T
309 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaagttccgaatcaaagtacggagtttctttattgcagttcaatgccttttctgcttct 408  Q
33531290 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaagttccgaatcaaagtacggagtttctttattgcagttcaatgccttttctgcttct 33531389  T
409 cccaacctgcattaaaattttcaattctatnnnnnnncaataacacaaaaagaaacacaaccattaatataactaagtgattgagctcaagtaatagtgg 508  Q
    ||||||||||||||||||||||||||||||       |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
33531390 cccaacctgcattaaaattttcaattctataaaaaaacaataacacaaaaacaaacacaaccattaatataactaagtgattgagcccaagtaatagtgg 33531489  T
509 gttttatttaattacaaattgattgggagttcccgagtttgaaccccgattgaaacaacttttggtccaacttaacttatctcccatccgaactccagat 608  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
33531490 gttttatttaattacaaattgattgggagttcccgagtttgaaccccgattgaaataacttttggtccgacttaacttatctcccatccgaactccagat 33531589  T
609 taccagggtcacttcccctcttaattcagaggattaagacaggtatactatttaattgagtgaagcatattaagttattcatcattaacaagtacctgaa 708  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531590 taccagggtcacttcccctcttaattcagaggattaagaaaggtatactatttaattgagtgaagcatattaagttattcatcattaacaagtacctgaa 33531689  T
709 gtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaaccttcccaaacca 808  Q
33531690 gtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaaccttcccaaacca 33531789  T
809 atcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatcttccttgtt 908  Q
33531790 atcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatcttccttgtt 33531889  T
909 tgtatgcttcatttcccattgattttaacacctca-ggtctagtattctgttgcttctaggacttcgaaattgtgacacaccatca-cac-tttcctcat 1005  Q
    ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||    
33531890 tgtatgcttcatttcccattgatttcaacacctcagggtctagtattctgttgcttctaggacttcgaaattgtgacacaccatcaccacttttcctcat 33531989  T
1006 tatattccccattacactgttattcacagaacatgacacaagaatc-actctttattattccttgtaacacttg-tcttgggctg 1088  Q
    ||||||||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||||||||||| ||||||||||    
33531990 tatattccccattacactgttattcacagaacatgacacagaattcaactctttattattccttgtaacacttgttcttgggctg 33532074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 102; Significance: 4e-50; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 102; E-Value: 4e-50
Query Start/End: Original strand, 700 - 945
Target Start/End: Original strand, 26209619 - 26209864
700 gtacctgaagtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaacctt 799  Q
    ||||||||| |||||||| ||||||||  | ||||||||   ||||||||| || | || ||||| |||||||||||||| |||||| |  |||||||||    
26209619 gtacctgaaatatattgttgccaaacgattgtgagctctgttataagaaggatccaaccgaatagattcctcacactcaataattgcttcttgaaacctt 26209718  T
800 cccaaaccaatcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatc 899  Q
    || || |||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| |||   ||||||||||||||||||||   |||      
26209719 cctaatccaatcaaagcagcactcttattgcaatgataagttgccttatttgaatcaatagcaattgctttgtcatacaaagccaaagcctcttcaaact 26209818  T
900 ttccttgtttgtatgcttcatttcccattgattttaacacctcagg 945  Q
    | || | ||||||||||||||||||||||||||| ||||| |||||    
26209819 taccctttttgtatgcttcatttcccattgatttcaacacttcagg 26209864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 209 - 353
Target Start/End: Original strand, 26209083 - 26209227
209 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 308  Q
    ||||| ||||||||| ||||||||||||  |||||||||||| |||||||||||||||||| | || |||  |||| || |||| |||||| || ||  |    
26209083 caaaggaactaacctgtggagctgaatcggcacctaaggataatgcagactgtgtttcctttagtacaacactccattcattgaatttcctagcttctat 26209182  T
309 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaag 353  Q
    |||||| || | ||||  ||| |||||||||||||| ||| ||||    
26209183 gcatttcttcaggtgattttgtagagcctgagcttgaaaagcaag 26209227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 366 times since January 2019
Visitors: 133