View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-1 (Length: 1088)

Name: NF4429-Insertion-1
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-1
NF4429-Insertion-1
[»] chr3 (1 HSPs)
chr3 (9-1088)||(33530990-33532074)
[»] chr5 (2 HSPs)
chr5 (700-945)||(26209619-26209864)
chr5 (209-353)||(26209083-26209227)


Alignment Details
Target: chr3 (Bit Score: 939; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 939; E-Value: 0
Query Start/End: Original strand, 9 - 1088
Target Start/End: Original strand, 33530990 - 33532074
Alignment:
9 caaggtcaaattttggcattttctcgtaaattgtatatgcttcttgctgtcttaggagcttcaacaaggcttctgtttgtaaagcatagacctggtagac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
33530990 caaggtcaaattttggcattttctcgtaaattgtatatgcttcttgctgtcttaggagcttcaacaaggcttcagtttgtaaagcatagacctggtagac 33531089  T
109 ataaccannnnnnnaatcagcataagagggttattggccaatgagttgagtaacatatgattnnnnnnnntgtaggagtgcctaaaataaaacatttaac 208  Q
    |||||||       ||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||    
33531090 ataaccatttttttaatcagcataagagggttattggccaatgagttgagtaacatatgattaaaaaaaatgtaggagtgcctaaaataaaacatttaac 33531189  T
209 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531190 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 33531289  T
309 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaagttccgaatcaaagtacggagtttctttattgcagttcaatgccttttctgcttct 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531290 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaagttccgaatcaaagtacggagtttctttattgcagttcaatgccttttctgcttct 33531389  T
409 cccaacctgcattaaaattttcaattctatnnnnnnncaataacacaaaaagaaacacaaccattaatataactaagtgattgagctcaagtaatagtgg 508  Q
    ||||||||||||||||||||||||||||||       |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||    
33531390 cccaacctgcattaaaattttcaattctataaaaaaacaataacacaaaaacaaacacaaccattaatataactaagtgattgagcccaagtaatagtgg 33531489  T
509 gttttatttaattacaaattgattgggagttcccgagtttgaaccccgattgaaacaacttttggtccaacttaacttatctcccatccgaactccagat 608  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||    
33531490 gttttatttaattacaaattgattgggagttcccgagtttgaaccccgattgaaataacttttggtccgacttaacttatctcccatccgaactccagat 33531589  T
609 taccagggtcacttcccctcttaattcagaggattaagacaggtatactatttaattgagtgaagcatattaagttattcatcattaacaagtacctgaa 708  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531590 taccagggtcacttcccctcttaattcagaggattaagaaaggtatactatttaattgagtgaagcatattaagttattcatcattaacaagtacctgaa 33531689  T
709 gtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaaccttcccaaacca 808  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531690 gtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaaccttcccaaacca 33531789  T
809 atcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatcttccttgtt 908  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33531790 atcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatcttccttgtt 33531889  T
909 tgtatgcttcatttcccattgattttaacacctca-ggtctagtattctgttgcttctaggacttcgaaattgtgacacaccatca-cac-tttcctcat 1005  Q
    ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||    
33531890 tgtatgcttcatttcccattgatttcaacacctcagggtctagtattctgttgcttctaggacttcgaaattgtgacacaccatcaccacttttcctcat 33531989  T
1006 tatattccccattacactgttattcacagaacatgacacaagaatc-actctttattattccttgtaacacttg-tcttgggctg 1088  Q
    ||||||||||||||||||||||||||||||||||||||||  | || ||||||||||||||||||||||||||| ||||||||||    
33531990 tatattccccattacactgttattcacagaacatgacacagaattcaactctttattattccttgtaacacttgttcttgggctg 33532074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 102; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 4e-50
Query Start/End: Original strand, 700 - 945
Target Start/End: Original strand, 26209619 - 26209864
Alignment:
700 gtacctgaagtatattgtcgccaaacggctatgagctctaggataagaagggtcaatcctaatagcttcctcacactcaacaattgcatgctgaaacctt 799  Q
    ||||||||| |||||||| ||||||||  | ||||||||   ||||||||| || | || ||||| |||||||||||||| |||||| |  |||||||||    
26209619 gtacctgaaatatattgttgccaaacgattgtgagctctgttataagaaggatccaaccgaatagattcctcacactcaataattgcttcttgaaacctt 26209718  T
800 cccaaaccaatcaaagcagcactcttgttacaatgataagttgccttattggaatcaatagcaatagctcgttcatacaaagccaaagcctcagaaaatc 899  Q
    || || |||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| |||   ||||||||||||||||||||   |||      
26209719 cctaatccaatcaaagcagcactcttattgcaatgataagttgccttatttgaatcaatagcaattgctttgtcatacaaagccaaagcctcttcaaact 26209818  T
900 ttccttgtttgtatgcttcatttcccattgattttaacacctcagg 945  Q
    | || | ||||||||||||||||||||||||||| ||||| |||||    
26209819 taccctttttgtatgcttcatttcccattgatttcaacacttcagg 26209864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 209 - 353
Target Start/End: Original strand, 26209083 - 26209227
Alignment:
209 caaagaaactaacctttggagctgaatccacacctaaggatattgcagactgtgtttccttcaatataactttccaatccttgactttcctggcctcact 308  Q
    ||||| ||||||||| ||||||||||||  |||||||||||| |||||||||||||||||| | || |||  |||| || |||| |||||| || ||  |    
26209083 caaaggaactaacctgtggagctgaatcggcacctaaggataatgcagactgtgtttcctttagtacaacactccattcattgaatttcctagcttctat 26209182  T
309 gcatttgttaaagtgaacttgaagagcctgagcttggaaatcaag 353  Q
    |||||| || | ||||  ||| |||||||||||||| ||| ||||    
26209183 gcatttcttcaggtgattttgtagagcctgagcttgaaaagcaag 26209227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295197 times since January 2019
Visitors: 3016