View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-10 (Length: 528)

Name: NF4429-Insertion-10
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-10
[»] chr7 (1 HSPs)
chr7 (8-517)||(26029927-26030432)

Alignment Details
Target: chr7 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 8 - 517
Target Start/End: Original strand, 26029927 - 26030432
8 atgcaatggtcaggagttcgattgttggcttatgtgtaccgaaaaaattcagttgagagtggagaatcaaccttgtgtgtcctacatattctccgttaac 107  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||    
26029927 atgcaatgggcaggagttcgattgttggctcatgtgtaccgaaaaaattcggttgagagtagagaatcaaccttgtgtgtcctacatattctccgttaac 26030026  T
108 aacattgtgtgtcccacatattctccaacggagagtagtcgctgtcacttagcaatagaaacttctttgtgtcaatattatggtaaaataaaaaagagat 207  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26030027 aacattgtgtgtcccacatattctccaatggagattagtcgctgtcacttagcaatagaaacttctctgtgtcaatattatggtaaaataaaaaagagat 26030126  T
208 aggtgaggattgttcacctagagtttaggaagtaaggattgatgagactgaactactctctaattaatgcatacaaacaattgattaatttatttatata 307  Q
    |||||||||||||| |||||||||||| ||||    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26030127 aggtgaggattgtttacctagagtttaagaag----gattgatgagagtgaactactctctaattaatgcatacaaacaattgattaatttatttatata 26030222  T
308 acacttcttacttgtcctattaaataggttggacatgcacttcaatctgccatgcaagcaggagtggaaaggaaggatctattcatcacctccaagatat 407  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26030223 acacttcttacttgtcctgctaaataggttggacatgcacttcaatctgccatgcaagcaggagtggaaaggaaggatctattcatcacctccaagatat 26030322  T
408 ggtaataatgtaattacatatagaaacacgttaatacatatactctttaggtctttatgttgattcaattgaatttgatggtgtgaaattttatggctgc 507  Q
    |||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26030323 ggtaataatgtaattacatatagagacatgttaatacatataatctttaggtctttatgttgattcaattgaatttgattgtgtgaaattttatggctgc 26030422  T
508 tattctaggt 517  Q
26030423 tattctaggt 26030432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318546 times since January 2019
Visitors: 3039