View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-10 (Length: 528)

Name: NF4429-Insertion-10
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-10
NF4429-Insertion-10
[»] chr7 (1 HSPs)
chr7 (8-517)||(26029927-26030432)


Alignment Details
Target: chr7 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 8 - 517
Target Start/End: Original strand, 26029927 - 26030432
Alignment:
8 atgcaatggtcaggagttcgattgttggcttatgtgtaccgaaaaaattcagttgagagtggagaatcaaccttgtgtgtcctacatattctccgttaac 107  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||    
26029927 atgcaatgggcaggagttcgattgttggctcatgtgtaccgaaaaaattcggttgagagtagagaatcaaccttgtgtgtcctacatattctccgttaac 26030026  T
108 aacattgtgtgtcccacatattctccaacggagagtagtcgctgtcacttagcaatagaaacttctttgtgtcaatattatggtaaaataaaaaagagat 207  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26030027 aacattgtgtgtcccacatattctccaatggagattagtcgctgtcacttagcaatagaaacttctctgtgtcaatattatggtaaaataaaaaagagat 26030126  T
208 aggtgaggattgttcacctagagtttaggaagtaaggattgatgagactgaactactctctaattaatgcatacaaacaattgattaatttatttatata 307  Q
    |||||||||||||| |||||||||||| ||||    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26030127 aggtgaggattgtttacctagagtttaagaag----gattgatgagagtgaactactctctaattaatgcatacaaacaattgattaatttatttatata 26030222  T
308 acacttcttacttgtcctattaaataggttggacatgcacttcaatctgccatgcaagcaggagtggaaaggaaggatctattcatcacctccaagatat 407  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26030223 acacttcttacttgtcctgctaaataggttggacatgcacttcaatctgccatgcaagcaggagtggaaaggaaggatctattcatcacctccaagatat 26030322  T
408 ggtaataatgtaattacatatagaaacacgttaatacatatactctttaggtctttatgttgattcaattgaatttgatggtgtgaaattttatggctgc 507  Q
    |||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26030323 ggtaataatgtaattacatatagagacatgttaatacatataatctttaggtctttatgttgattcaattgaatttgattgtgtgaaattttatggctgc 26030422  T
508 tattctaggt 517  Q
    ||||||||||    
26030423 tattctaggt 26030432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125331 times since January 2019
Visitors: 1457