View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-12 (Length: 344)

Name: NF4429-Insertion-12
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-12
NF4429-Insertion-12
[»] chr7 (6 HSPs)
chr7 (7-344)||(18658765-18659102)
chr7 (7-344)||(21111643-21111980)
chr7 (7-344)||(21130603-21130940)
chr7 (15-214)||(21098402-21098601)
chr7 (15-126)||(21108109-21108220)
chr7 (39-79)||(29213203-29213243)
[»] chr4 (1 HSPs)
chr4 (7-301)||(39131839-39132133)
[»] chr3 (12 HSPs)
chr3 (7-109)||(26751170-26751272)
chr3 (7-109)||(26713998-26714100)
chr3 (6-109)||(26744244-26744347)
chr3 (7-109)||(26737234-26737336)
chr3 (39-133)||(47212441-47212535)
chr3 (39-112)||(26690342-26690415)
chr3 (39-112)||(26731653-26731726)
chr3 (39-109)||(26698878-26698948)
chr3 (39-112)||(26694503-26694576)
chr3 (7-139)||(47193352-47193484)
chr3 (39-109)||(26734041-26734111)
chr3 (7-67)||(9792524-9792584)


Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 7 - 344
Target Start/End: Original strand, 18658765 - 18659102
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||    
18658765 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatatcaatcaagttcatgtggttaagccgtccaatgatgcttacttcagcaag 18658864  T
107 aaattctccttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctctt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18658865 aaattctccttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctctt 18658964  T
207 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactatatcttctgaatcccaataataaatgatgatagttatgttgatctccac 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
18658965 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactatatcttctgaatcccaataatacatgatgatagttatgttgatctccac 18659064  T
307 tagaatttttcttggtcttaattaaaaaaccacaaacc 344  Q
    ||||||||||||||||||||||||||||||||||||||    
18659065 tagaatttttcttggtcttaattaaaaaaccacaaacc 18659102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 7 - 344
Target Start/End: Original strand, 21111643 - 21111980
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||||||| |||||    
21111643 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttctatcaagttcatgtggttaagccgtccaatgatacttacttcggcaag 21111742  T
107 aaattctccttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctctt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
21111743 aaattctccttctccttgtttagcttcatttaatctctttattgctacatgtctttcatctggcaatgtacctctatatacaatccctcctccacctctt 21111842  T
207 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactatatcttctgaatcccaataataaatgatgatagttatgttgatctccac 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||  |||||||||||||||| ||||||||     
21111843 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactgtatcttctgaatccaaataatgcatgatgatagttatgtcgatctccat 21111942  T
307 tagaatttttcttggtcttaattaaaaaaccacaaacc 344  Q
    |||  ||||||| |||||| |||||||||| |||||||    
21111943 taggctttttctcggtcttgattaaaaaacaacaaacc 21111980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 344
Target Start/End: Original strand, 21130603 - 21130940
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||   | ||||||||||||||||||||||    
21130603 actcatataccaaaattctatgcttaccttcaacacaatatccccacatttcaatcaaattcatgtggttaagcttttcaatgatgcttacttcagcaag 21130702  T
107 aaattctccttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctctt 206  Q
    ||| |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||  |||||||||||||||    
21130703 aaactctccttctccttgtttagcttcattcaatctctttattgctgcatctctttgatccggcaatgtacctctatatacaactcctcctccacctctt 21130802  T
207 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactatatcttctgaatcccaataataaatgatgatagttatgttgatctccac 306  Q
    |||||||| ||||||||||| ||||| |||| |||||||||||||||| | |||||||||||||| ||||||  | |||||||| ||||||||| | |||    
21130803 ccaatctcgttactgaaattttttgtcgctaccttcaactcggagtaagtgtatcttctgaatcctaataatgtaagatgatagctatgttgatttgcac 21130902  T
307 tagaatttttcttggtcttaattaaaaaaccacaaacc 344  Q
    ||||||||||| ||||||||||||||||||||||||||    
21130903 tagaatttttcctggtcttaattaaaaaaccacaaacc 21130940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 21098601 - 21098402
Alignment:
15 accaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattctc 114  Q
    ||||| |||||||  || || ||||| ||||||||||||||||| |||||||||||||| ||||| | ||||||||| | ||||||||| |||||||| |    
21098601 accaatagtctatattttccctcagcgcaatatccccacatttcgatcaaattcatgtgattaagccttccaatgattcctacttcagctagaaattcac 21098502  T
115 cttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctcttccaatctc 214  Q
    |||| |||||||  || |  |  | |||||||||||| |||||||||  ||| |  ||| | ||| | |||||||  |||||||||||||||||||||||    
21098501 cttcaccttgttgtgcattgtaaagtctctttattgcagcatgtcttccatcagataatatgcctttgtatacaacacctcctccacctcttccaatctc 21098402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 21108220 - 21108109
Alignment:
15 accaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattctc 114  Q
    ||||| |||||||  || || ||||| ||||||||||||||||| |||||||||||||| ||||| | ||||||||| | ||||||||| |||||||| |    
21108220 accaatagtctatattttccctcagcgcaatatccccacatttcgatcaaattcatgtgattaagccttccaatgattcctacttcagctagaaattcac 21108121  T
115 cttctccttgtt 126  Q
    ||||||||||||    
21108120 cttctccttgtt 21108109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 29213203 - 29213243
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaag 79  Q
    |||||||| ||||||| ||||||||||||||||||||||||    
29213203 gcacaataaccccacaattcaatcaaattcatgtggttaag 29213243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 7 - 301
Target Start/End: Complemental strand, 39132133 - 39131839
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||||||||||| |||||||||||||||| |||||||||||||||||||||| || |||||||| || || | ||| ||||||||||||||||||||    
39132133 actcatataccaaaattctatgcttaccttcaacacaatatccccacatttcaattaagttcatgtgattgagccttccgatgatgcttacttcagcaag 39132034  T
107 aaattctccttctccttgtttagcttcatttaatctctttattgctgcatgtctttgatctggcaatgtacctctatatacaatccctcctccacctctt 206  Q
    ||| |||||||| ||||| ||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||   ||||||| ||||||||| ||| ||    
39132033 aaactctccttccccttgattagcttcattcaatctctttattgctgcttgtctttgatccggcaatgtacctaggtatacaacccctcctccgcctttt 39131934  T
207 ccaatctcattactgaaattctttgttgctatcttcaactcggagtaactatatcttctgaatcccaataataaatgatgatagttatgttgatc 301  Q
    ||||||||||||||||||||||| ||||| | ||||||||| |||||||| |||||||||||||||||||||  |||||||||| ||| ||||||    
39131933 ccaatctcattactgaaattcttggttgccaccttcaactccgagtaactgtatcttctgaatcccaataatgtatgatgatagctattttgatc 39131839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 26751170 - 26751272
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||| ||||| | ||||||||| || ||||||||||| ||||||||  |||||||||||||||||||||| | |||||||||||| ||||| |||||    
26751170 actcataaaccaacaatctatgctttccctcagcacaataaccccacataccaatcaaattcatgtggttaagccttccaatgatgctaacttcggcaag 26751269  T
107 aaa 109  Q
    |||    
26751270 aaa 26751272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 26713998 - 26714100
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||| ||||| | | |||| || || ||||||||||| ||||||||| |||||||||||||||||||||| | |||||||||||| ||||| |||||    
26713998 actcataaaccaacaatttatgttttccctcagcacaataaccccacattccaatcaaattcatgtggttaagccttccaatgatgctaacttctgcaag 26714097  T
107 aaa 109  Q
    |||    
26714098 aaa 26714100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 109
Target Start/End: Original strand, 26744244 - 26744347
Alignment:
6 cactcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaa 105  Q
    ||||| || ||||| | |||||| || || ||||||||||| ||||||||  |||| || |||||||||||||| | |||||||||||||||||||||||    
26744244 cactcgtaaaccaacaatctatgttttccctcagcacaatagccccacataccaattaagttcatgtggttaagccttccaatgatgcttacttcagcaa 26744343  T
106 gaaa 109  Q
    ||||    
26744344 gaaa 26744347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 26737234 - 26737336
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||| ||||| | | |||| || || ||||||||||| ||||||||| |||| ||||||||||||||||| | |||||||||||| ||||| |||||    
26737234 actcataaaccaacaatttatgttttccctcagcacaataaccccacattccaattaaattcatgtggttaagccttccaatgatgctaacttctgcaag 26737333  T
107 aaa 109  Q
    |||    
26737334 aaa 26737336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 39 - 133
Target Start/End: Original strand, 47212441 - 47212535
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattctccttctccttgtttagcttc 133  Q
    |||||||| ||||||||||||||||||||||||||||||||   ||||||| |||||||||| || ||||| ||| |||| ||||| || |||||    
47212441 gcacaataaccccacatttcaatcaaattcatgtggttaagctttccaatgctgcttacttctgcgagaaactcttcttcgccttgatttgcttc 47212535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 112
Target Start/End: Complemental strand, 26690415 - 26690342
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattc 112  Q
    |||||||| ||||||||  |||||||||||||||||||||| | |||||||| ||| |||||||||||||||||    
26690415 gcacaatacccccacataccaatcaaattcatgtggttaagccttccaatgacgctaacttcagcaagaaattc 26690342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 112
Target Start/End: Complemental strand, 26731726 - 26731653
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattc 112  Q
    |||||||| ||||||||  |||||||||||||||||||||| | |||||||| ||| |||||||||||||||||    
26731726 gcacaatacccccacataccaatcaaattcatgtggttaagccttccaatgacgctaacttcagcaagaaattc 26731653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 26698878 - 26698948
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaa 109  Q
    |||||||| ||||||||| | |||||||||||||| ||||| | |||||||||||| ||||||||||||||    
26698878 gcacaataaccccacattcctatcaaattcatgtgattaagccttccaatgatgctaacttcagcaagaaa 26698948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 39 - 112
Target Start/End: Complemental strand, 26694576 - 26694503
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaattc 112  Q
    |||||||| ||||||||  |||||||||||||||||||||| | |||||||| ||| | |||||||||||||||    
26694576 gcacaatacccccacataccaatcaaattcatgtggttaagccttccaatgacgctaagttcagcaagaaattc 26694503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 47193484 - 47193352
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaag 106  Q
    ||||||| |||||||| ||||| || |||||| |||||||||||||||| ||||| |||||||| ||||| |     |||||  |||||| |||||| ||    
47193484 actcatagaccaaaagcctatgtttcccttcaacacaatatccccacatatcaattaaattcatatggttcaacataccaattgtgcttatttcagctag 47193385  T
107 aaattctccttctccttgtttagcttcatttaa 139  Q
    ||||||  ||||||| || | ||||||||||||    
47193384 aaattcagcttctccctgatgagcttcatttaa 47193352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 26734041 - 26734111
Alignment:
39 gcacaatatccccacatttcaatcaaattcatgtggttaagtcgtccaatgatgcttacttcagcaagaaa 109  Q
    |||||||| ||||||||| | |||||||||||||| ||||| | |||||||||||| |||||| |||||||    
26734041 gcacaataaccccacattcctatcaaattcatgtgattaagccttccaatgatgctaacttcaacaagaaa 26734111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 67
Target Start/End: Complemental strand, 9792584 - 9792524
Alignment:
7 actcatataccaaaagtctatgcttaccttcagcacaatatccccacatttcaatcaaatt 67  Q
    ||||||| |||||||||||||  || |||||| |||||||||||||||| ||||| |||||    
9792584 actcataaaccaaaagtctatttttcccttcaacacaatatccccacatatcaattaaatt 9792524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18468 times since January 2019
Visitors: 1569