View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-13 (Length: 299)

Name: NF4429-Insertion-13
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-13
NF4429-Insertion-13
[»] scaffold0187 (4 HSPs)
scaffold0187 (9-279)||(6942-7212)
scaffold0187 (9-279)||(17270-17540)
scaffold0187 (9-163)||(183-331)
scaffold0187 (46-161)||(27675-27791)
[»] chr1 (5 HSPs)
chr1 (9-125)||(37855174-37855286)
chr1 (46-161)||(37911286-37911402)
chr1 (13-260)||(37881248-37881485)
chr1 (122-246)||(37854808-37854926)
chr1 (10-94)||(37867379-37867461)
[»] chr7 (1 HSPs)
chr7 (9-94)||(9239942-9240025)


Alignment Details
Target: scaffold0187 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 6942 - 7212
Alignment:
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6942 gggggtctcagtttatatagtactaactattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 7041  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttg 208  Q
     | |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7042 atattcatggtttaaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttg 7141  T
209 acttgatttgttatgtgattggtgttggttgtgtttttctttcaatgatgcatgtttatcggggtgggtag 279  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
7142 acttgatttgttatgtgattggttttggttgtgtttttctttcaatgatgcatgtttatcggggtgagtag 7212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 17270 - 17540
Alignment:
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17270 gggggtctcagtttatatagtactaactattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 17369  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttg 208  Q
     | |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17370 atattcatggtttaaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttg 17469  T
209 acttgatttgttatgtgattggtgttggttgtgtttttctttcaatgatgcatgtttatcggggtgggtag 279  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
17470 acttgatttgttatgtgattggttttggttgtgtttttctttcaatgatgcatgtttatcggggtgagtag 17540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 183 - 331
Alignment:
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| |||||||||||| ||||| ||||||    |||||||||||||||||| |||||||  |||||| |||||||||||||||||||||||||    
183 gggggtctcagtttatatagtaccaattactactaa----acaccctttttgttaaacaaagacaa--ggaatcggattcaaaccactagggtgagtcca 276  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttg 163  Q
     | ||||||||||||||||| |||| |||||| |||||||||||| |||||||||    
277 atattcatggtttaaacaagttcacatggaacagtaaattatgattcaacttttg 331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 161
Target Start/End: Original strand, 27675 - 27791
Alignment:
46 taaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgttc--atggtttaaacaagatcacgtggaactgt 143  Q
    |||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||||  |||| | |||  ||||||||||||||||||| |||||||||    
27675 taaacaacctttttgttaaacttagacaaa-ggaatctgattcaaaccactggggtgtctccaatattcctatggtttaaacaagatcacatggaactgt 27773  T
144 aaattatgatacaacttt 161  Q
    |||||||||| |||||||    
27774 aaattatgattcaacttt 27791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 9 - 125
Target Start/End: Complemental strand, 37855286 - 37855174
Alignment:
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    ||||||||||||||||||||||||||||||||||||    |||||| |||||||||||||||||||| |||||||||||||||| ||| |||||||||||    
37855286 gggggtctcaatttatatagtactaattattactaa----acaccccttttgttaaactaagacaaagggaatctgattcaaacaactggggtgagtcca 37855191  T
109 ttgttcatggtttaaac 125  Q
     | ||||||||| ||||    
37855190 atattcatggttcaaac 37855174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 161
Target Start/End: Complemental strand, 37911402 - 37911286
Alignment:
46 taaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgttc--atggtttaaacaagatcacgtggaactgt 143  Q
    |||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||||  |||| | |||  ||||||||||||||||||| |||||||||    
37911402 taaacaacctttttgttaaacttagacaaa-ggaatctgattcaaaccactggggtgtctccaatattcctatggtttaaacaagatcacatggaactgt 37911304  T
144 aaattatgatacaacttt 161  Q
    |||||||||| |||||||    
37911303 aaattatgattcaacttt 37911286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 13 - 260
Target Start/End: Complemental strand, 37881485 - 37881248
Alignment:
13 gtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgt 112  Q
    |||| ||||||||||||||||||||   || | ||||||||||||| |||||||||||||| | |||||||||||||| ||| |  ||||||| || | |    
37881485 gtcttaatttatatagtactaatta---ctca-taaacaccctttt-gttaaactaagacagagggaatctgattcaacccattgaggtgagttcaatat 37881391  T
113 tcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttgactt 212  Q
    || ||||||||||||  ||| |||||||  |||||||| || ||||||||| |  ||||||||||    | ||||| ||||| |||||||| || |||||    
37881390 tcttggtttaaacaaactcatgtggaacattaaattatcattcaacttttggactaggtacattt----tttgtggtccgatggtttcttt-ctagactt 37881296  T
213 gatttgttatgtgattggtgttggttgtgtttttctttcaatgatgca 260  Q
    |||| ||  ||||||||||||||  ||||||| |  ||||||||||||    
37881295 gattagtcgtgtgattggtgttgaatgtgtttcttattcaatgatgca 37881248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 122 - 246
Target Start/End: Complemental strand, 37854926 - 37854808
Alignment:
122 aaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttgacttgatttgtta 221  Q
    |||||||||||| |||||| || ||||||||| ||||||||  | |||||||||||    ||||||||||||| ||||| ||||||||||||| | || |    
37854926 aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacattt----tatgtggcccgatggtttc-ttgcttgacttga-tagtca 37854833  T
222 tgtgattggtgttggttgtgttttt 246  Q
    |||||||||||||||||||||||||    
37854832 tgtgattggtgttggttgtgttttt 37854808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 37867461 - 37867379
Alignment:
10 ggggtctcaatttatatagtactaattattactaactaaaca-ccctttttgttaaactaagacaaaaggaatctgattcaaacca 94  Q
    |||||||||||||||||||||| ||||| |||||| |||||| || |||||||||| ||||||||||  |||||||||||||||||    
37867461 ggggtctcaatttatatagtacaaattactactaa-taaacagccttttttgttaagctaagacaaa--gaatctgattcaaacca 37867379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 9239942 - 9240025
Alignment:
9 gggggtctcaatttatatagtactaattattactaactaaac-accctttttgttaaactaagacaaaaggaatctgattcaaacca 94  Q
    ||||||||||||||||||||||| ||||| |||||| ||||| ||| ||||| |||| ||||||||||  |||||||||||||||||    
9239942 gggggtctcaatttatatagtacaaattactactaa-taaacaaccttttttattaagctaagacaaa--gaatctgattcaaacca 9240025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295454 times since January 2019
Visitors: 3016