View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-13 (Length: 299)

Name: NF4429-Insertion-13
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-13
[»] scaffold0187 (4 HSPs)
scaffold0187 (9-279)||(6942-7212)
scaffold0187 (9-279)||(17270-17540)
scaffold0187 (9-163)||(183-331)
scaffold0187 (46-161)||(27675-27791)
[»] chr1 (5 HSPs)
chr1 (9-125)||(37855174-37855286)
chr1 (46-161)||(37911286-37911402)
chr1 (13-260)||(37881248-37881485)
chr1 (122-246)||(37854808-37854926)
chr1 (10-94)||(37867379-37867461)
[»] chr7 (1 HSPs)
chr7 (9-94)||(9239942-9240025)

Alignment Details
Target: scaffold0187 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: scaffold0187

Target: scaffold0187; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 6942 - 7212
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6942 gggggtctcagtttatatagtactaactattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 7041  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttg 208  Q
     | |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7042 atattcatggtttaaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttg 7141  T
209 acttgatttgttatgtgattggtgttggttgtgtttttctttcaatgatgcatgtttatcggggtgggtag 279  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
7142 acttgatttgttatgtgattggttttggttgtgtttttctttcaatgatgcatgtttatcggggtgagtag 7212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 17270 - 17540
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17270 gggggtctcagtttatatagtactaactattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 17369  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttg 208  Q
     | |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17370 atattcatggtttaaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttg 17469  T
209 acttgatttgttatgtgattggtgttggttgtgtttttctttcaatgatgcatgtttatcggggtgggtag 279  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
17470 acttgatttgttatgtgattggttttggttgtgtttttctttcaatgatgcatgtttatcggggtgagtag 17540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 183 - 331
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    |||||||||| |||||||||||| ||||| ||||||    |||||||||||||||||| |||||||  |||||| |||||||||||||||||||||||||    
183 gggggtctcagtttatatagtaccaattactactaa----acaccctttttgttaaacaaagacaa--ggaatcggattcaaaccactagggtgagtcca 276  T
109 ttgttcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttg 163  Q
     | ||||||||||||||||| |||| |||||| |||||||||||| |||||||||    
277 atattcatggtttaaacaagttcacatggaacagtaaattatgattcaacttttg 331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 161
Target Start/End: Original strand, 27675 - 27791
46 taaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgttc--atggtttaaacaagatcacgtggaactgt 143  Q
    |||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||||  |||| | |||  ||||||||||||||||||| |||||||||    
27675 taaacaacctttttgttaaacttagacaaa-ggaatctgattcaaaccactggggtgtctccaatattcctatggtttaaacaagatcacatggaactgt 27773  T
144 aaattatgatacaacttt 161  Q
    |||||||||| |||||||    
27774 aaattatgattcaacttt 27791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 5)
Name: chr1

Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 9 - 125
Target Start/End: Complemental strand, 37855286 - 37855174
9 gggggtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtcca 108  Q
    ||||||||||||||||||||||||||||||||||||    |||||| |||||||||||||||||||| |||||||||||||||| ||| |||||||||||    
37855286 gggggtctcaatttatatagtactaattattactaa----acaccccttttgttaaactaagacaaagggaatctgattcaaacaactggggtgagtcca 37855191  T
109 ttgttcatggtttaaac 125  Q
     | ||||||||| ||||    
37855190 atattcatggttcaaac 37855174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 161
Target Start/End: Complemental strand, 37911402 - 37911286
46 taaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgttc--atggtttaaacaagatcacgtggaactgt 143  Q
    |||||| ||||||||||||||| ||||||| |||||||||||||||||||| |||||  |||| | |||  ||||||||||||||||||| |||||||||    
37911402 taaacaacctttttgttaaacttagacaaa-ggaatctgattcaaaccactggggtgtctccaatattcctatggtttaaacaagatcacatggaactgt 37911304  T
144 aaattatgatacaacttt 161  Q
    |||||||||| |||||||    
37911303 aaattatgattcaacttt 37911286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 13 - 260
Target Start/End: Complemental strand, 37881485 - 37881248
13 gtctcaatttatatagtactaattattactaactaaacaccctttttgttaaactaagacaaaaggaatctgattcaaaccactagggtgagtccattgt 112  Q
    |||| ||||||||||||||||||||   || | ||||||||||||| |||||||||||||| | |||||||||||||| ||| |  ||||||| || | |    
37881485 gtcttaatttatatagtactaatta---ctca-taaacaccctttt-gttaaactaagacagagggaatctgattcaacccattgaggtgagttcaatat 37881391  T
113 tcatggtttaaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttgactt 212  Q
    || ||||||||||||  ||| |||||||  |||||||| || ||||||||| |  ||||||||||    | ||||| ||||| |||||||| || |||||    
37881390 tcttggtttaaacaaactcatgtggaacattaaattatcattcaacttttggactaggtacattt----tttgtggtccgatggtttcttt-ctagactt 37881296  T
213 gatttgttatgtgattggtgttggttgtgtttttctttcaatgatgca 260  Q
    |||| ||  ||||||||||||||  ||||||| |  ||||||||||||    
37881295 gattagtcgtgtgattggtgttgaatgtgtttcttattcaatgatgca 37881248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 122 - 246
Target Start/End: Complemental strand, 37854926 - 37854808
122 aaacaagatcacgtggaactgtaaattatgatacaacttttgcataaggtacattttatatatgtggcccgattgtttctttgcttgacttgatttgtta 221  Q
    |||||||||||| |||||| || ||||||||| ||||||||  | |||||||||||    ||||||||||||| ||||| ||||||||||||| | || |    
37854926 aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacattt----tatgtggcccgatggtttc-ttgcttgacttga-tagtca 37854833  T
222 tgtgattggtgttggttgtgttttt 246  Q
37854832 tgtgattggtgttggttgtgttttt 37854808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 37867461 - 37867379
10 ggggtctcaatttatatagtactaattattactaactaaaca-ccctttttgttaaactaagacaaaaggaatctgattcaaacca 94  Q
    |||||||||||||||||||||| ||||| |||||| |||||| || |||||||||| ||||||||||  |||||||||||||||||    
37867461 ggggtctcaatttatatagtacaaattactactaa-taaacagccttttttgttaagctaagacaaa--gaatctgattcaaacca 37867379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 94
Target Start/End: Original strand, 9239942 - 9240025
9 gggggtctcaatttatatagtactaattattactaactaaac-accctttttgttaaactaagacaaaaggaatctgattcaaacca 94  Q
    ||||||||||||||||||||||| ||||| |||||| ||||| ||| ||||| |||| ||||||||||  |||||||||||||||||    
9239942 gggggtctcaatttatatagtacaaattactactaa-taaacaaccttttttattaagctaagacaaa--gaatctgattcaaacca 9240025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125141 times since January 2019
Visitors: 1453