View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-14 (Length: 287)

Name: NF4429-Insertion-14
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-14
NF4429-Insertion-14
[»] chr3 (1 HSPs)
chr3 (8-287)||(41066546-41066825)


Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 41066546 - 41066825
Alignment:
8 actactctctatttttctctgtatcatttgatacttgttggatattaaaattctcgtatcttcacttaaagttactgataaagatgtagacagttctttt 107  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41066546 actactctctatttttctctttatcatttgatacttgttggatattaaaattctcgtatcttcacttaaagttactgataaagatgtagacagttctttt 41066645  T
108 atccttcatcatcaaactatatatagttctcttttgtaatggatttacagcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtgg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41066646 atccttcatcatcaaactatatatagttctcttttgtaatggatttacagcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtgg 41066745  T
208 aacttcagtacgtgcggaagatatataaaagaaatgactcatatagttcgccccttaaagttttaagtaaagatgttgtg 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41066746 aacttcagtacgtgcggaagatatataaaagaaatgactcatatagttcgccccttaaagttttaagtaaagatgttgtg 41066825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295250 times since January 2019
Visitors: 3016