View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-14 (Length: 287)

Name: NF4429-Insertion-14
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-14
[»] chr3 (1 HSPs)
chr3 (8-287)||(41066546-41066825)

Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 41066546 - 41066825
8 actactctctatttttctctgtatcatttgatacttgttggatattaaaattctcgtatcttcacttaaagttactgataaagatgtagacagttctttt 107  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41066546 actactctctatttttctctttatcatttgatacttgttggatattaaaattctcgtatcttcacttaaagttactgataaagatgtagacagttctttt 41066645  T
108 atccttcatcatcaaactatatatagttctcttttgtaatggatttacagcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtgg 207  Q
41066646 atccttcatcatcaaactatatatagttctcttttgtaatggatttacagcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtgg 41066745  T
208 aacttcagtacgtgcggaagatatataaaagaaatgactcatatagttcgccccttaaagttttaagtaaagatgttgtg 287  Q
41066746 aacttcagtacgtgcggaagatatataaaagaaatgactcatatagttcgccccttaaagttttaagtaaagatgttgtg 41066825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109758 times since January 2019
Visitors: 1349