View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-18 (Length: 65)

Name: NF4429-Insertion-18
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-18
NF4429-Insertion-18
[»] chr3 (1 HSPs)
chr3 (7-65)||(32796181-32796239)


Alignment Details
Target: chr3 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 32796239 - 32796181
Alignment:
7 agaatagatattaacaatccactcagctcaagaatgcaagtgagattgatccgtgtata 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
32796239 agaatagatattaacaatccactcagctcaagaatgcaagtgagattgatccatgtata 32796181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37903 times since January 2019
Visitors: 1598