View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-2 (Length: 1079)

Name: NF4429-Insertion-2
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-2
NF4429-Insertion-2
[»] chr4 (1 HSPs)
chr4 (7-1076)||(22084501-22085574)
[»] chr1 (1 HSPs)
chr1 (452-513)||(31641899-31641960)


Alignment Details
Target: chr4 (Bit Score: 980; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 980; E-Value: 0
Query Start/End: Original strand, 7 - 1076
Target Start/End: Original strand, 22084501 - 22085574
Alignment:
7 attattgtccttgtagatcccatttgagattctttctgcaacagtgatgttgttactgacaagtgatttggtgcttcttgctgattctgattctgacttc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22084501 attattgtccttgtagatcccatttgagattctttctgcaacagtgatgttgttactgacaagtgatttggtgcttcttgctgattctgattctgacttc 22084600  T
107 tactcaagtacaaagagcttattacactagcagacaaatctttgttttcttcttgttcttgtttcattactccatgtagcattggcaaagatagattagt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
22084601 tactcaagtacaaagagcttattacactagcagacaaatctttgttttcttcttgttcttgtttcattactccatgtagcattggcaaagatagattagc 22084700  T
207 attattataattcagccactgtggttgtgatccaaacacatccattgtttgcattatatcagaattttgatgaagatgagaaatgttagtgtaatttccc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
22084701 attattataattcagccactgtggttgtgatccaaacacatccattgtttgcattatatcagaattttgatgaagttgagaaatgttagtgtaatttccc 22084800  T
307 aatggtggttctgatgatgttgctgaattaacaaattccgagtgaaactgaaaaccaggaaaaatatgaggaattcttggagtttgagtattcgtcaaat 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22084801 aatggtggttctgatgatgttgctgaattaacaaattccgagtgaaactgaaaaccaggaaaaatatgaggaattcttggagtttgagtattcgtcaaat 22084900  T
407 gatcattccgaaagttgcttaaagctgccggaaccgttgttatctttgcactttgttcagttaatgcatcacaaaaagctctatgtgttataaagctgtc 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
22084901 gatcattccgaaagttgcttaaagctgccggaaccgttgttatctttgcactttgttcagttaatgcatcacaaaaagctctatgtgttatgaagctgtc 22085000  T
507 cttcctgatttgttagcaaacataataaataaatacataaatgaattagttgaacatcaattaacattcctcatttattatctattccatacaaacattc 606  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
22085001 cttcctgatttgttagcacacataataaataaatacataaatgaattagttgaacatcaattaacattcctcatttattatttattccatacaaacattc 22085100  T
607 cttcaattatatctagcacatgcatccaatccattaaattaatcaaacttaatgatttaagaaggcatttaaattgcagcaatataaaagattttgagat 706  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22085101 cttcaattatatctagcacatgcatccaatccattaaattaatcaaacttaatgatttaagaaggcatttaaattgcagcaatataaaagattttgagat 22085200  T
707 ctacccaaccatatcaaaactactttttcggttgcattggccgcaactgcgaccgccattaaaatcatgaaattaaggacatttgaaatttaaatgctaa 806  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
22085201 ctacccaaccatatcaaaacttctttttcggttgcattggccgcaactgcaaccgccattaaaatcatgaaattaaggacatttgaaatttaaatgctaa 22085300  T
807 ttgttggatatagactaaacgtttaaactaattgatcaccaagatttctatattcttttagtgtttcaattttctatagcttccaaatattgcagccact 906  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
22085301 ttgttggatatagactaaacgtttaaactaattgatcaccaagatttctatattcttttagtgtttcaattttctattgcttccaaatattgcagccact 22085400  T
907 acgggagtcactggatccgagtttag-aaatgtaaattgtttctatctcaaatccaac-gtgccagtagtgactgctatggcgaaagatagtaaatatat 1004  Q
    || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22085401 ac-ggagtcactggatccgagtttagaaaatgtaaattgtttctatctcaaatccaacggtgccagtagtgactgctatggcgaaagatagtaaatatat 22085499  T
1005 agtatatacctggag-aaattgtg-cacaatcacatttgtactcttctag-tccacaaatc-tgctatgagctttc 1076  Q
    ||||||||||||||| |||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||||||    
22085500 agtatatacctggagaaaattgtgccacaatcacatttgtactc-tctagttccacaaatcttgctatgagctttc 22085574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 452 - 513
Target Start/End: Original strand, 31641899 - 31641960
Alignment:
452 ttgcactttgttcagttaatgcatcacaaaaagctctatgtgttataaagctgtccttcctg 513  Q
    ||||||||| |||||  |||||||||||||| |||||||| ||||| ||||| |||||||||    
31641899 ttgcactttcttcagccaatgcatcacaaaatgctctatgagttatgaagctatccttcctg 31641960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37932 times since January 2019
Visitors: 1598