View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-2 (Length: 1079)

Name: NF4429-Insertion-2
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-2
[»] chr4 (1 HSPs)
chr4 (7-1076)||(22084501-22085574)
[»] chr1 (1 HSPs)
chr1 (452-513)||(31641899-31641960)

Alignment Details
Target: chr4 (Bit Score: 980; Significance: 0; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 980; E-Value: 0
Query Start/End: Original strand, 7 - 1076
Target Start/End: Original strand, 22084501 - 22085574
7 attattgtccttgtagatcccatttgagattctttctgcaacagtgatgttgttactgacaagtgatttggtgcttcttgctgattctgattctgacttc 106  Q
22084501 attattgtccttgtagatcccatttgagattctttctgcaacagtgatgttgttactgacaagtgatttggtgcttcttgctgattctgattctgacttc 22084600  T
107 tactcaagtacaaagagcttattacactagcagacaaatctttgttttcttcttgttcttgtttcattactccatgtagcattggcaaagatagattagt 206  Q
22084601 tactcaagtacaaagagcttattacactagcagacaaatctttgttttcttcttgttcttgtttcattactccatgtagcattggcaaagatagattagc 22084700  T
207 attattataattcagccactgtggttgtgatccaaacacatccattgtttgcattatatcagaattttgatgaagatgagaaatgttagtgtaatttccc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
22084701 attattataattcagccactgtggttgtgatccaaacacatccattgtttgcattatatcagaattttgatgaagttgagaaatgttagtgtaatttccc 22084800  T
307 aatggtggttctgatgatgttgctgaattaacaaattccgagtgaaactgaaaaccaggaaaaatatgaggaattcttggagtttgagtattcgtcaaat 406  Q
22084801 aatggtggttctgatgatgttgctgaattaacaaattccgagtgaaactgaaaaccaggaaaaatatgaggaattcttggagtttgagtattcgtcaaat 22084900  T
407 gatcattccgaaagttgcttaaagctgccggaaccgttgttatctttgcactttgttcagttaatgcatcacaaaaagctctatgtgttataaagctgtc 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
22084901 gatcattccgaaagttgcttaaagctgccggaaccgttgttatctttgcactttgttcagttaatgcatcacaaaaagctctatgtgttatgaagctgtc 22085000  T
507 cttcctgatttgttagcaaacataataaataaatacataaatgaattagttgaacatcaattaacattcctcatttattatctattccatacaaacattc 606  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
22085001 cttcctgatttgttagcacacataataaataaatacataaatgaattagttgaacatcaattaacattcctcatttattatttattccatacaaacattc 22085100  T
607 cttcaattatatctagcacatgcatccaatccattaaattaatcaaacttaatgatttaagaaggcatttaaattgcagcaatataaaagattttgagat 706  Q
22085101 cttcaattatatctagcacatgcatccaatccattaaattaatcaaacttaatgatttaagaaggcatttaaattgcagcaatataaaagattttgagat 22085200  T
707 ctacccaaccatatcaaaactactttttcggttgcattggccgcaactgcgaccgccattaaaatcatgaaattaaggacatttgaaatttaaatgctaa 806  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
22085201 ctacccaaccatatcaaaacttctttttcggttgcattggccgcaactgcaaccgccattaaaatcatgaaattaaggacatttgaaatttaaatgctaa 22085300  T
807 ttgttggatatagactaaacgtttaaactaattgatcaccaagatttctatattcttttagtgtttcaattttctatagcttccaaatattgcagccact 906  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
22085301 ttgttggatatagactaaacgtttaaactaattgatcaccaagatttctatattcttttagtgtttcaattttctattgcttccaaatattgcagccact 22085400  T
907 acgggagtcactggatccgagtttag-aaatgtaaattgtttctatctcaaatccaac-gtgccagtagtgactgctatggcgaaagatagtaaatatat 1004  Q
    || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22085401 ac-ggagtcactggatccgagtttagaaaatgtaaattgtttctatctcaaatccaacggtgccagtagtgactgctatggcgaaagatagtaaatatat 22085499  T
1005 agtatatacctggag-aaattgtg-cacaatcacatttgtactcttctag-tccacaaatc-tgctatgagctttc 1076  Q
    ||||||||||||||| |||||||| ||||||||||||||||||| ||||| |||||||||| ||||||||||||||    
22085500 agtatatacctggagaaaattgtgccacaatcacatttgtactc-tctagttccacaaatcttgctatgagctttc 22085574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 452 - 513
Target Start/End: Original strand, 31641899 - 31641960
452 ttgcactttgttcagttaatgcatcacaaaaagctctatgtgttataaagctgtccttcctg 513  Q
    ||||||||| |||||  |||||||||||||| |||||||| ||||| ||||| |||||||||    
31641899 ttgcactttcttcagccaatgcatcacaaaatgctctatgagttatgaagctatccttcctg 31641960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175982 times since January 2019
Visitors: 2679