View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-3 (Length: 1013)

Name: NF4429-Insertion-3
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-3
[»] chr7 (1 HSPs)
chr7 (4-1002)||(38358892-38359895)
[»] chr2 (2 HSPs)
chr2 (388-637)||(7554152-7554401)
chr2 (757-794)||(7555271-7555308)
[»] chr5 (2 HSPs)
chr5 (702-793)||(25515444-25515535)
chr5 (702-792)||(25519840-25519930)

Alignment Details
Target: chr7 (Bit Score: 930; Significance: 0; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 930; E-Value: 0
Query Start/End: Original strand, 4 - 1002
Target Start/End: Original strand, 38358892 - 38359895
4 aacaagaagaatgataattgttgtatcattgaaagcttcaagcacaaaatgtaaaagaccttttggtggtggctttttgtaagtatttgaaccgaacaac 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
38358892 aacaagaagaatgataattgttgtatcattgaaagcttcaagcacaaaatgtaaaagaccttttggtggtggttttttgtaagtatttgaaccgaacaac 38358991  T
104 tcgagccgtctcaaaatatcatcgtcacttccaataattccctttgttggaaatgttccaagaacatgtccaacaccttcaactcctccaaactcactta 203  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
38358992 tcgagccgtctcgaaatatcatcgtcacttccaataattccctttgttggaaatgttccaagaacatgtccaacaccttcaactccaccaaactcactta 38359091  T
204 aggacttcaagtttttgtccttaaccatatcagcaagtttggtcttatcaac---aacatcagaaaccaaagagtaatgattggttccattatgttgtgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
38359092 aggacttcaagtttttgtccttaaccatatcagcaagtttggtcttatcaacaacaacatcagaaaccaaagagtaatgattggttccattatgttgtgt 38359191  T
301 aattagtggttcaattatatcaagagtagtggtggaacttgaagattctgtgtgaaagagttttgtgtaagggttagagttttttctagatataacctct 400  Q
38359192 aattagtggttcaattatatcaagagtagtggtggaacttgaagattctgtgtgaaagagttttgtgtaagggttagagttttttctagatataacctct 38359291  T
401 tttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtgactttggtgaggg 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
38359292 tttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtgactttggcgaggg 38359391  T
501 tattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagagtatgagaagaaat 600  Q
38359392 tattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagagtatgagaagaaat 38359491  T
601 atctagtttgaggaaaggactaggaaagaacttcattctgtagttacaaggatggttgcataaatatatatagacatttttatatttgtcgtgttaaagt 700  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38359492 atctagtttgaggaaagaactaggaaagaacttcattctgtagttacaaggatggttgcataaatatatatagacatttttatatttgtcgtgttaaagt 38359591  T
701 gtacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaaaggtggga 800  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||  ||    
38359592 gtacatgaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatctaatttggtcaaaggtatga 38359691  T
801 aaaggacttttttaacatataaacattcttgcggtgcaatttaaatggtttttgctaagaagaaagtaacaagtttgatactaatacacattaaatggaa 900  Q
38359692 aaaggacttttttaacatataaacattcttgcggtgcaatttaaatggtttttgctaagaagaaagtaacaagtttgatactaatacacattaaatggaa 38359791  T
901 gtaatgtatagttgaaatttcagaataaaaactgatgcacgatctgtgtaatg-aaaatatac-tagtgggatgcattttcatgaagtcgacataaaact 998  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
38359792 gtaatgtatagtggaaatttcaaaataaaaactgatgcacgatctgtgtaatgaaaaatatacttagtgggatgcattttcatgaagtcgacataaaact 38359891  T
999 gagt 1002  Q
38359892 gagt 38359895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 388 - 637
Target Start/End: Original strand, 7554152 - 7554401
388 agatataacctcttttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtg 487  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
7554152 agatatgacctcttttgcaagggaaagcataacccttctagaataaatagttgtgtatgcaaaacgccaccttctttttgtattggtgtatttggaagtg 7554251  T
488 actttggtgagggtattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagag 587  Q
    |||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |||||||    
7554252 actttggtgaaggtattggtgatgtcaatgatcaacgaggtaccatcatattgtagattatgattaatagagatggtggtattttactaaagctttagag 7554351  T
588 tatgagaagaaatatctagtttgaggaaaggactaggaaagaacttcatt 637  Q
7554352 aatgagaagaaatatctagtttgaggaaaggactaggaaagaacttcatt 7554401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 757 - 794
Target Start/End: Original strand, 7555271 - 7555308
757 tttctttatgtttttgttgttatttaatttggtcaaag 794  Q
    ||||||||||||||||||||||  ||||||||||||||    
7555271 tttctttatgtttttgttgttacctaatttggtcaaag 7555308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 80; Significance: 5e-37; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 702 - 793
Target Start/End: Original strand, 25515444 - 25515535
702 tacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaaa 793  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
25515444 tacatgaaatagtttccatgtaacttcctagcaaaactatgaaatctacactgtatttctttatgtttttgttgttatctaatttggtcaaa 25515535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 7e-27
Query Start/End: Original strand, 702 - 792
Target Start/End: Complemental strand, 25519930 - 25519840
702 tacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaa 792  Q
    ||||| ||||||||| ||||||||||||||| |||||||||||||||| | |||||||||||||||| |||||||||| ||||||||||||    
25519930 tacatgaaatagttttcatgtaacttcctagcaaaactatgaaatctatagtgtatttctttatgttcttgttgttatctaatttggtcaa 25519840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111616 times since January 2019
Visitors: 1375