View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-3 (Length: 1013)

Name: NF4429-Insertion-3
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-3
NF4429-Insertion-3
[»] chr7 (1 HSPs)
chr7 (4-1002)||(38358892-38359895)
[»] chr2 (2 HSPs)
chr2 (388-637)||(7554152-7554401)
chr2 (757-794)||(7555271-7555308)
[»] chr5 (2 HSPs)
chr5 (702-793)||(25515444-25515535)
chr5 (702-792)||(25519840-25519930)


Alignment Details
Target: chr7 (Bit Score: 930; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 930; E-Value: 0
Query Start/End: Original strand, 4 - 1002
Target Start/End: Original strand, 38358892 - 38359895
Alignment:
4 aacaagaagaatgataattgttgtatcattgaaagcttcaagcacaaaatgtaaaagaccttttggtggtggctttttgtaagtatttgaaccgaacaac 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
38358892 aacaagaagaatgataattgttgtatcattgaaagcttcaagcacaaaatgtaaaagaccttttggtggtggttttttgtaagtatttgaaccgaacaac 38358991  T
104 tcgagccgtctcaaaatatcatcgtcacttccaataattccctttgttggaaatgttccaagaacatgtccaacaccttcaactcctccaaactcactta 203  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
38358992 tcgagccgtctcgaaatatcatcgtcacttccaataattccctttgttggaaatgttccaagaacatgtccaacaccttcaactccaccaaactcactta 38359091  T
204 aggacttcaagtttttgtccttaaccatatcagcaagtttggtcttatcaac---aacatcagaaaccaaagagtaatgattggttccattatgttgtgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
38359092 aggacttcaagtttttgtccttaaccatatcagcaagtttggtcttatcaacaacaacatcagaaaccaaagagtaatgattggttccattatgttgtgt 38359191  T
301 aattagtggttcaattatatcaagagtagtggtggaacttgaagattctgtgtgaaagagttttgtgtaagggttagagttttttctagatataacctct 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38359192 aattagtggttcaattatatcaagagtagtggtggaacttgaagattctgtgtgaaagagttttgtgtaagggttagagttttttctagatataacctct 38359291  T
401 tttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtgactttggtgaggg 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
38359292 tttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtgactttggcgaggg 38359391  T
501 tattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagagtatgagaagaaat 600  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38359392 tattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagagtatgagaagaaat 38359491  T
601 atctagtttgaggaaaggactaggaaagaacttcattctgtagttacaaggatggttgcataaatatatatagacatttttatatttgtcgtgttaaagt 700  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38359492 atctagtttgaggaaagaactaggaaagaacttcattctgtagttacaaggatggttgcataaatatatatagacatttttatatttgtcgtgttaaagt 38359591  T
701 gtacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaaaggtggga 800  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||  ||    
38359592 gtacatgaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatctaatttggtcaaaggtatga 38359691  T
801 aaaggacttttttaacatataaacattcttgcggtgcaatttaaatggtttttgctaagaagaaagtaacaagtttgatactaatacacattaaatggaa 900  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38359692 aaaggacttttttaacatataaacattcttgcggtgcaatttaaatggtttttgctaagaagaaagtaacaagtttgatactaatacacattaaatggaa 38359791  T
901 gtaatgtatagttgaaatttcagaataaaaactgatgcacgatctgtgtaatg-aaaatatac-tagtgggatgcattttcatgaagtcgacataaaact 998  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
38359792 gtaatgtatagtggaaatttcaaaataaaaactgatgcacgatctgtgtaatgaaaaatatacttagtgggatgcattttcatgaagtcgacataaaact 38359891  T
999 gagt 1002  Q
    ||||    
38359892 gagt 38359895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 388 - 637
Target Start/End: Original strand, 7554152 - 7554401
Alignment:
388 agatataacctcttttgcaagggaaagcataacccttctagaataaatagctgtgtatgcaaaacgccaccttctttttgcattggtgtatttggaagtg 487  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
7554152 agatatgacctcttttgcaagggaaagcataacccttctagaataaatagttgtgtatgcaaaacgccaccttctttttgtattggtgtatttggaagtg 7554251  T
488 actttggtgagggtattggtgatgtcaatgataaatgaggtaccatcatattgtagattatgattattagacatggtggaattttactaaaggtttagag 587  Q
    |||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |||||||    
7554252 actttggtgaaggtattggtgatgtcaatgatcaacgaggtaccatcatattgtagattatgattaatagagatggtggtattttactaaagctttagag 7554351  T
588 tatgagaagaaatatctagtttgaggaaaggactaggaaagaacttcatt 637  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||    
7554352 aatgagaagaaatatctagtttgaggaaaggactaggaaagaacttcatt 7554401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 757 - 794
Target Start/End: Original strand, 7555271 - 7555308
Alignment:
757 tttctttatgtttttgttgttatttaatttggtcaaag 794  Q
    ||||||||||||||||||||||  ||||||||||||||    
7555271 tttctttatgtttttgttgttacctaatttggtcaaag 7555308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 80; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 702 - 793
Target Start/End: Original strand, 25515444 - 25515535
Alignment:
702 tacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaaa 793  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
25515444 tacatgaaatagtttccatgtaacttcctagcaaaactatgaaatctacactgtatttctttatgtttttgttgttatctaatttggtcaaa 25515535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 7e-27
Query Start/End: Original strand, 702 - 792
Target Start/End: Complemental strand, 25519930 - 25519840
Alignment:
702 tacatcaaatagtttccatgtaacttcctagaaaaactatgaaatctacactgtatttctttatgtttttgttgttatttaatttggtcaa 792  Q
    ||||| ||||||||| ||||||||||||||| |||||||||||||||| | |||||||||||||||| |||||||||| ||||||||||||    
25519930 tacatgaaatagttttcatgtaacttcctagcaaaactatgaaatctatagtgtatttctttatgttcttgttgttatctaatttggtcaa 25519840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217260 times since January 2019
Visitors: 2908