View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-4 (Length: 1004)

Name: NF4429-Insertion-4
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-4
NF4429-Insertion-4
[»] chr7 (6 HSPs)
chr7 (8-1004)||(35424669-35425672)
chr7 (703-812)||(4332812-4332921)
chr7 (703-812)||(4337059-4337168)
chr7 (699-810)||(35356356-35356466)
chr7 (722-829)||(17115921-17116029)
chr7 (697-844)||(22713371-22713518)
[»] chr2 (6 HSPs)
chr2 (694-844)||(24510905-24511055)
chr2 (694-766)||(43050123-43050195)
chr2 (701-764)||(28816184-28816247)
chr2 (774-833)||(33928060-33928118)
chr2 (722-768)||(19572605-19572651)
chr2 (697-798)||(37267725-37267826)
[»] chr6 (9 HSPs)
chr6 (694-804)||(18075514-18075624)
chr6 (697-829)||(31596495-31596628)
chr6 (695-823)||(9540502-9540630)
chr6 (723-810)||(9929334-9929421)
chr6 (724-834)||(30525782-30525893)
chr6 (695-768)||(33240882-33240954)
chr6 (728-824)||(2396756-2396852)
chr6 (720-813)||(2119215-2119309)
chr6 (695-777)||(2513100-2513182)
[»] chr3 (8 HSPs)
chr3 (715-824)||(44053393-44053502)
chr3 (728-810)||(22318230-22318312)
chr3 (700-777)||(51715027-51715104)
chr3 (695-844)||(26665426-26665576)
chr3 (753-823)||(42110937-42111007)
chr3 (728-809)||(15462067-15462148)
chr3 (741-823)||(39745518-39745598)
chr3 (753-844)||(53852039-53852129)
[»] chr8 (7 HSPs)
chr8 (694-829)||(37507547-37507682)
chr8 (736-824)||(37325135-37325223)
chr8 (711-798)||(40899652-40899740)
chr8 (695-768)||(40506625-40506699)
chr8 (694-810)||(27157658-27157774)
chr8 (627-670)||(40607375-40607418)
chr8 (788-829)||(13818847-13818888)
[»] chr5 (10 HSPs)
chr5 (728-829)||(28503210-28503311)
chr5 (728-829)||(22017653-22017755)
chr5 (723-831)||(18401251-18401360)
chr5 (695-768)||(36183335-36183408)
chr5 (696-764)||(32176980-32177048)
chr5 (695-750)||(32177312-32177367)
chr5 (627-665)||(6830345-6830383)
chr5 (695-777)||(8217116-8217198)
chr5 (699-768)||(13169745-13169814)
chr5 (627-692)||(35290714-35290779)
[»] chr1 (5 HSPs)
chr1 (694-804)||(51474000-51474109)
chr1 (695-768)||(32556523-32556596)
chr1 (695-767)||(17339752-17339824)
chr1 (713-823)||(563821-563931)
chr1 (715-767)||(48400944-48400996)
[»] chr4 (4 HSPs)
chr4 (696-843)||(38303265-38303413)
chr4 (694-797)||(39791211-39791314)
chr4 (728-824)||(9689429-9689525)
chr4 (627-665)||(45921337-45921375)
[»] scaffold0071 (1 HSPs)
scaffold0071 (728-809)||(44-125)


Alignment Details
Target: chr7 (Bit Score: 754; Significance: 0; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 754; E-Value: 0
Query Start/End: Original strand, 8 - 1004
Target Start/End: Complemental strand, 35425672 - 35424669
Alignment:
8 actttgttataatactttttaaaatatatgatcagatgacactatcagtgcatagttcttaaaccctgatatattttgatattaaaatcattgagtatcc 107  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35425672 actttgttataatactttataaaatatatgatcagatgacactatcagtgcatagttcttaaaccctgatatattttgatattaaaatcattgagtatcc 35425573  T
108 caacctatcatacattcttgaacactacttactaagaacaaacctttcacatctcgtctcatacacttttgctttattgggagcattagtcctattttga 207  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
35425572 caacctatcatacattcttgaacactagttactaagaacaaacctttcacatcttgtctcatacacttttgctttcttgggagcattagtcctattttga 35425473  T
208 aatgaactttttaaaacactttctgtagacacttttgatgtaagtgctcttagcaaaattacaggtccccnnnnnnnn-----ctttattatgtgcttgt 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||             |||||||||||||||||    
35425472 aatgaactttttaaaacactttctgtagacacttttgatgtaagtgctcttagcataattacaggtcccctttttttctttttctttattatgtgcttgt 35425373  T
303 caccttactggccttgttattttcattgttggctcagcgtgccatgtagaaacaaaacaacaggtaacttctacttattttagattaacatatgtagtgt 402  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35425372 caccttactggccttgttattttcattgttggcttagcgtgccatgtagaaacaaaacaacaggtaacttctacttattttagattaacatatgtagtgt 35425273  T
403 acatgagtgatttgaannnnnnngaattcaacaatctttatatattatactcttaaataccaaatttcattatttaagtaacatagatacatatactttt 502  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
35425272 acatgagtgatttgaatttttttgaattcaacaatctttatatattatactcttaaataccaaatttcattatttaagtaacatatatacatatactttt 35425173  T
503 tacgatttatttagatagatgttaaccggtgccctacagacattggttaagcaactaaaacaaacnnnnnnnnnnttaataaaaagtagtgtagtcgtta 602  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||    
35425172 tacgatttatttagatagatgttaaccggtgctctacagacattggttaagcaactaaaacaaacaaaaaaaaa-ttaataaaaagtagtgtagtcgtta 35425074  T
603 cttggtcaaatgcctagcttacacttttcaagacaaattttctatttataaatttcttaaccaatgcctctggaacactagttagcaagagccctatgag 702  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||| ||||||||||| ||||||||    
35425073 cttggtcaaatgcctaacttacacttttcaagacaaaatttctatttataaatttcttaaccaa-gtctctggaacactggttagcaagagtcctatgag 35424975  T
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||| ||||||||||||| ||| ||||||||||||||||||||| |  ||||||||||||||||||||||||| ||| |||| |||||||||||||||    
35424974 tttctcgtgcgccctaatcgaattctaaaatctgaaatattttaacatattttggaggtttttatgcgatgtttatgccgttcagattctataatccaaa 35424875  T
803 ctgcatagaacgcgcgagaaattcataaggtgataaaagaaggtatctttatat----atatgttcgaaaaatcgctgcttagcttctctgggctggata 898  Q
    || ||||| |||| ||||||||||||||| ||||||||||||||||||||||||    ||||||||||||||||| ||||||||||||||||||||||||    
35424874 ctacataggacgcacgagaaattcataagatgataaaagaaggtatctttatatatatatatgttcgaaaaatcgatgcttagcttctctgggctggata 35424775  T
899 ggcccactatttcttttggacctacaatgtgtgctaacgtgttgcttaatcactct-ccaaatcttctcagttgatcaatgcaacaagttaattggagga 997  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||    
35424774 ggcccactatttcttttggacctacaatgtgtgctaacgtgttgcttaatcactctcccaaatc-tctcagttgatcaatgaaacaagttaattggagga 35424676  T
998 atgatat 1004  Q
    |||||||    
35424675 atgatat 35424669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 703 - 812
Target Start/End: Original strand, 4332812 - 4332921
Alignment:
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||||||| || || ||| ||| ||||||||||||||||||||| |  ||| ||| |||||||   ||||||  ||||||  ||||||||||||||||    
4332812 tttctcatgcaccttattcgtattctaaaatctgaaatattttaacttcttttagagatttttatcgaatgtttttgccattggaattctataatccaaa 4332911  T
803 ctgcatagaa 812  Q
     |||||||||    
4332912 ttgcatagaa 4332921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 703 - 812
Target Start/End: Original strand, 4337059 - 4337168
Alignment:
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||||||| || || ||| ||| ||||||||||||||||||||| |  ||| ||| |||||||   ||||||  ||||||  ||||||||||||||||    
4337059 tttctcatgcaccttattcgtattctaaaatctgaaatattttaacttcttttagagatttttatcgaatgtttttgccattggaattctataatccaaa 4337158  T
803 ctgcatagaa 812  Q
     |||||||||    
4337159 ttgcatagaa 4337168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 699 - 810
Target Start/End: Complemental strand, 35356466 - 35356356
Alignment:
699 tgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatc 798  Q
    |||||||||| |||| |||| | | ||| ||||||| ||||| |||||||||| |||||||||||||||| | | |||||| | |||  ||| |||||||    
35356466 tgagtttctcgtgcgtcctatttgaattctaaaatccgaaatgttttaacgtgttttggaggtttttatggggt-tttacgtcgttcggattatataatc 35356368  T
799 caaactgcatag 810  Q
    | ||||||||||    
35356367 cgaactgcatag 35356356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 722 - 829
Target Start/End: Original strand, 17115921 - 17116029
Alignment:
722 ggattataaaatctgaaatattttaacgtgatttggag-gtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgag 820  Q
    ||||| |||||||| |||||||| |||||| ||| ||  ||||||||| | |||||| | | ||| ||||||||||| |||||||| ||| ||| |||||    
17115921 ggattttaaaatctaaaatatttcaacgtgtttttgaaagtttttatggggtgtttatgtcgttcgaattctataatacaaactgcgtaggacgtgcgag 17116020  T
821 aaattcata 829  Q
    ||| |||||    
17116021 aaactcata 17116029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 697 - 844
Target Start/End: Complemental strand, 22713518 - 22713371
Alignment:
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctata 795  Q
    |||||||||||| |||||| || | | ||| ||||||||||||||||| |||||| ||| |||||||||||   | |||||| |||||||  ||| ||||    
22713518 tatgagtttctcgtgcgcc-tatttgaattttaaaatctgaaatatttcaacgtgtttttggaggtttttacagggtgtttatgccattcggattttata 22713420  T
796 atccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    ||| |||||  |||||  ||| |||||| ||||||| ||  ||||||||    
22713419 atctaaactatatagagtgcgtgagaaactcataagatgggaaaagaag 22713371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 2e-24; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 694 - 844
Target Start/End: Original strand, 24510905 - 24511055
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    |||||||||||| |||  | ||||| ||||||| ||||||||||||||||| |||||  |||||||||||||||| |||||||| ||| ||  |||||||    
24510905 ccctatgagtttttcacacaccctattcggattttaaaatctgaaatatttaaacgtattttggaggtttttatgggatgtttatgccgtttgaattcta 24511004  T
794 taatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||| | ||||||||||    ||||||||||||||| | ||| ||||||||    
24511005 taattcgaactgcatagggaacgcgagaaattcataggttgaaaaaagaag 24511055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 694 - 766
Target Start/End: Original strand, 43050123 - 43050195
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggttttta 766  Q
    ||||||||||||||    |||| || ||||||| ||||||||||||| ||| |||||| ||||||||||||||    
43050123 ccctatgagtttcttgcacgccttattcggattttaaaatctgaaatgtttcaacgtgttttggaggttttta 43050195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 701 - 764
Target Start/End: Complemental strand, 28816247 - 28816184
Alignment:
701 agtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttt 764  Q
    |||||||| ||||||||| ||  |||||||||| | |||||||| |||||| ||||||||||||    
28816247 agtttctcgtgcgccctattcaaattataaaattttaaatatttcaacgtgttttggaggtttt 28816184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 833
Target Start/End: Original strand, 33928060 - 33928118
Alignment:
774 tttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattcataaggt 833  Q
    |||| |||||||||||||||||||| ||||| ||||| |||||||||||| | |||||||    
33928060 tttatgccattcaaattctataatctaaactacatag-acgcgcgagaaactgataaggt 33928118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 722 - 768
Target Start/End: Original strand, 19572605 - 19572651
Alignment:
722 ggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    ||||| ||||||||||||| |||||||||| |||||| |||||||||    
19572605 ggattttaaaatctgaaatgttttaacgtgttttggaagtttttatg 19572651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 697 - 798
Target Start/End: Original strand, 37267725 - 37267826
Alignment:
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataa 796  Q
    |||||| ||||| || |||||| | ||||| ||||||| |||||||||||||||| |||||  | ||||||| ||| ||||  |  |||| |||||||||    
37267725 tatgagcttctcgtgtgccctatttggattctaaaatccgaaatattttaacgtgttttgggaggttttatgagatttttatacagttcagattctataa 37267824  T
797 tc 798  Q
    ||    
37267825 tc 37267826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 4e-22; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 694 - 804
Target Start/End: Complemental strand, 18075624 - 18075514
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||  ||||| |||||||||| | ||||||   | |||| ||||||    
18075624 ccctatgagtttctcatgcgccctattcaaattataaaatctgaaatattttaacgtcttttggtggtttttatggggtgtttatttcgttcagattcta 18075525  T
794 taatccaaact 804  Q
    |||||| ||||    
18075524 taatccgaact 18075514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 697 - 829
Target Start/End: Complemental strand, 31596628 - 31596495
Alignment:
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctata 795  Q
    |||||||||||  ||||||||| ||| ||| ||||||||||||| ||| |||||| ||| ||||| ||||||  | |||||| ||| ||||||||||| |    
31596628 tatgagtttcttgtgcgccctattcgaattttaaaatctgaaatgtttcaacgtgtttttggaggattttattgggtgtttatgccgttcaaattctaca 31596529  T
796 atccaaactgcatagaacgcgcgagaaattcata 829  Q
    ||| |||||| |||| |||||||| ||| |||||    
31596528 atctaaactgtataggacgcgcgaaaaactcata 31596495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 695 - 823
Target Start/End: Complemental strand, 9540630 - 9540502
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctat 794  Q
    ||||||||||||||| |||||||| || |||| ||||||||||||||| ||| |||  |||| ||| ||||||  | |||||| | |||||||||| |||    
9540630 cctatgagtttctcacgcgccctattcagattctaaaatctgaaatatcttaccgttttttgaaggattttatagggtgtttatgtcattcaaattttat 9540531  T
795 aatccaaactgcatagaacgcgcgagaaa 823  Q
    |||  ||||||||||| | |||| |||||    
9540530 aatttaaactgcataggaagcgcaagaaa 9540502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 723 - 810
Target Start/End: Original strand, 9929334 - 9929421
Alignment:
723 gattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatag 810  Q
    |||| ||||||||||||| ||| |||||| |||||||||||||||| | |||||| | | ||| ||||||||||||| ||||||||||    
9929334 gattttaaaatctgaaatctttcaacgtgttttggaggtttttatgaggtgtttatgacgttcgaattctataatccgaactgcatag 9929421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 724 - 834
Target Start/End: Complemental strand, 30525893 - 30525782
Alignment:
724 attataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaa 822  Q
    |||||| |||| ||||| ||| |||||| ||| ||||||||||||| |||||||| ||| |||  ||||||||||||||| |||||||  || |||||||    
30525893 attatagaatccgaaatgtttcaacgtgtttttggaggtttttatgagatgtttatgccgttcggattctataatccaaattgcatagggcgtgcgagaa 30525794  T
823 attcataaggtg 834  Q
    | ||||| ||||    
30525793 actcatagggtg 30525782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 695 - 768
Target Start/End: Complemental strand, 33240954 - 33240882
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||||||| ||||||||| ||||||| ||||||| ||||||||| |||||  |||| |||||||||||    
33240954 cctatgagtttctcgtgcgccctattcggattctaaaatccgaaatatttcaacgt-ttttgaaggtttttatg 33240882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 728 - 824
Target Start/End: Original strand, 2396756 - 2396852
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    |||||||  ||||||||||||||  |||| ||||||||||  | |||||| | ||||| |||||||||||| |||||||||| | |||| |||||||    
2396756 taaaatccaaaatattttaacgtattttgtaggtttttatagggtgtttatgtcattcgaattctataatctaaactgcataaagcgcgtgagaaat 2396852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 720 - 813
Target Start/End: Complemental strand, 2119309 - 2119215
Alignment:
720 tcggattataaaatctgaaatattttaacgtgatttggagg-tttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaac 813  Q
    ||||||| || |||| |||||||||||||||| ||| || | ||||||||  ||||||| | | ||| ||||| |||||||||||||||||||||    
2119309 tcggattctacaatccgaaatattttaacgtgtttttgaagatttttatgaaatgtttatgtctttcgaattccataatccaaactgcatagaac 2119215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 695 - 777
Target Start/End: Original strand, 2513100 - 2513182
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    ||||||||||||||  ||||| || || |||| |||||||  |||| ||||||| |||||||||| |||||||| | ||||||    
2513100 cctatgagtttctctcgcgccttattcagattctaaaatccaaaatgttttaacatgatttggagatttttatgaggtgttta 2513182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 4e-19; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 715 - 824
Target Start/End: Original strand, 44053393 - 44053502
Alignment:
715 cctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacg 814  Q
    ||||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||| |||| ||| |||   || |||||||||||||  ||||  ||    
44053393 cctaatcggattataaaatccaaaatattttaacgtgctttggaggtttttatgggatatttatgccgttcgggttatataatccaaactatatagggcg 44053492  T
815 cgcgagaaat 824  Q
    ||||||||||    
44053493 cgcgagaaat 44053502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 728 - 810
Target Start/End: Original strand, 22318230 - 22318312
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatag 810  Q
    |||||| |||||| ||||||| || |||| ||||||||||| |||||||| || |||| ||||||||||||| ||||||||||    
22318230 taaaatatgaaatgttttaacatgttttgaaggtttttatgagatgtttatgctattcgaattctataatccgaactgcatag 22318312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 700 - 777
Target Start/End: Original strand, 51715027 - 51715104
Alignment:
700 gagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    |||||||||  |||||| | ||||||| ||||||||||||| |||||||||| |||||||||||||||| | ||||||    
51715027 gagtttctcgcgcgcccgattcggattctaaaatctgaaatgttttaacgtgttttggaggtttttatggggtgttta 51715104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 695 - 844
Target Start/End: Complemental strand, 26665576 - 26665426
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttg-gaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||  ||| |||| | ||||| ||||||| ||||||||| ||| || |||  ||  |||||||| | |||||| ||| |||  ||||||    
26665576 cctatgagtttctcgcgcgtcctatttggattttaaaatccgaaatatttcaacatgttttccgaaatttttatgggttgtttatgccgttcggattcta 26665477  T
794 taatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||| ||||||||||||  ||||||||||| ||||| ||||  ||||||||    
26665476 taattcaaactgcatagggcgcgcgagaaactcatatggtgggaaaagaag 26665426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 753 - 823
Target Start/End: Complemental strand, 42111007 - 42110937
Alignment:
753 tttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaa 823  Q
    |||||||||||||||| | |||||| | | ||| ||||||||||||||| ||||||||  |||||||||||    
42111007 tttggaggtttttatggggtgtttatgtcgttcgaattctataatccaacctgcatagggcgcgcgagaaa 42110937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 728 - 809
Target Start/End: Original strand, 15462067 - 15462148
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcata 809  Q
    ||||||||||||||||| |||||| ||| |||||||||||| | |||||| ||| ||   |||||||||| | |||||||||    
15462067 taaaatctgaaatatttaaacgtgttttagaggtttttatggggtgtttatgccgtttggattctataattcgaactgcata 15462148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 823
Target Start/End: Complemental strand, 39745598 - 39745518
Alignment:
741 attttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaa 823  Q
    ||||||||||| ||| ||||||| ||||  ||||||| ||| |||  || ||||||||| ||||||||||||||| |||||||    
39745598 attttaacgtgttttagaggtttatatg--atgtttatgccgttcggatcctataatccgaactgcatagaacgcacgagaaa 39745518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 753 - 844
Target Start/End: Complemental strand, 53852129 - 53852039
Alignment:
753 tttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||||||||||||||| | | |||| ||||||||||||||||||||| |||| |||||  || || ||||| ||||| ||||  ||||||||    
53852129 tttggaggtttttatggg-tatttatgccattcaaattctataatccgaactacatagggcgagcaagaaactcatacggtgggaaaagaag 53852039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 694 - 829
Target Start/End: Original strand, 37507547 - 37507682
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||   |||||||| ||| ||| ||||||| ||||| ||| |||||| |||||||||||||||| | | |||| | | |||| ||||||    
37507547 ccctatgagtttcttgcgcgccctattcgaattctaaaatccgaaatgtttcaacgtgttttggaggtttttatggggtatttatgtcgttcagattcta 37507646  T
794 taatccaaactgcatagaacgcgcgagaaattcata 829  Q
    ||| ||||| ||||||| | || ||||||| |||||    
37507647 taaaccaaattgcataggaagcacgagaaactcata 37507682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 736 - 824
Target Start/End: Original strand, 37325135 - 37325223
Alignment:
736 gaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    ||||| |||||||||| |||||||||||| ||| |||||||| | ||||  |||||||||||| ||| ||||||| ||||| |||||||    
37325135 gaaatgttttaacgtgttttggaggttttaatgggatgtttatgtcatttgaattctataatctaaattgcataggacgcgtgagaaat 37325223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 711 - 798
Target Start/End: Original strand, 40899652 - 40899740
Alignment:
711 gcgccctaatcggattataaaatctgaaatattttaacgtg-atttggaggtttttatgcgatgtttacgccattcaaattctataatc 798  Q
    |||||||| || |||| ||||||||||||||||||||||||  |||| ||||||||||| | |||||| ||| ||| |||| |||||||    
40899652 gcgccctattcagattttaaaatctgaaatattttaacgtgtttttgaaggtttttatggggtgtttatgcctttcgaattttataatc 40899740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 695 - 768
Target Start/End: Original strand, 40506625 - 40506699
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtga-tttggaggtttttatg 768  Q
    |||||||||||||| |  |||||| | ||||| ||||||| ||||||||| ||||||| ||||||||||||||||    
40506625 cctatgagtttctcgtatgccctatttggattgtaaaatccgaaatatttcaacgtgattttggaggtttttatg 40506699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 694 - 810
Target Start/End: Complemental strand, 27157774 - 27157658
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||| ||||  ||| ||||||| ||||||| ||| ||||| |||||| ||| |  | ||||||| | | |||| |||||||  ||||||    
27157774 ccctatgagtttctcgtgcgtgctattcggattctaaaatccgaattatttcaacgtggttttggagattttatggggtatttatgccattcggattcta 27157675  T
794 taatccaaactgcatag 810  Q
    |||||| || |||||||    
27157674 taatccgaaatgcatag 27157658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 627 - 670
Target Start/End: Original strand, 40607375 - 40607418
Alignment:
627 ttttcaagacaaattttctatttataaatttcttaaccaatgcc 670  Q
    |||| |||| ||||||||||||||||||||||||||||| ||||    
40607375 tttttaagataaattttctatttataaatttcttaaccattgcc 40607418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 788 - 829
Target Start/End: Original strand, 13818847 - 13818888
Alignment:
788 attctataatccaaactgcatagaacgcgcgagaaattcata 829  Q
    |||||||||||| |||| |||||||||||||||||| |||||    
13818847 attctataatccgaactacatagaacgcgcgagaaactcata 13818888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 728 - 829
Target Start/End: Complemental strand, 28503311 - 28503210
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattca 827  Q
    ||||||||||||||||| |||||  ||||||||||||||||   | |||| ||| ||| |||| ||||||||||||||||||| ||||| || ||| |||    
28503311 taaaatctgaaatatttcaacgtattttggaggtttttatggagtatttatgccgttcgaattttataatccaaactgcataggacgcgtgaaaaactca 28503212  T
828 ta 829  Q
    ||    
28503211 ta 28503210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 728 - 829
Target Start/End: Original strand, 22017653 - 22017755
Alignment:
728 taaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattc 826  Q
    ||||||||||||| ||| |||| | ||| ||||||||||||| | |||||| |||||||  |||||||||||| |||||||||| ||| || ||||| ||    
22017653 taaaatctgaaatgtttcaacgcgtttttggaggtttttatggggtgtttatgccattcggattctataatccgaactgcataggacgtgcaagaaactc 22017752  T
827 ata 829  Q
    |||    
22017753 ata 22017755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 723 - 831
Target Start/End: Original strand, 18401251 - 18401360
Alignment:
723 gattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgaga 821  Q
    ||||||| |||||||||| ||| |||||| ||| |||||| | |||| | |||||| ||  ||  ||||||||| ||| ||||||||||||||| |||||    
18401251 gattatagaatctgaaatgtttcaacgtgtttttggaggtctgtatgaggtgtttatgctttttgaattctatattccgaactgcatagaacgcacgaga 18401350  T
822 aattcataag 831  Q
    || |||||||    
18401351 aactcataag 18401360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 695 - 768
Target Start/End: Original strand, 36183335 - 36183408
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||||||| |||||| || ||||||| ||||||| ||||| ||| ||| |  ||||||||||||||||    
36183335 cctatgagtttctcgtgcgccatattcggattctaaaatccgaaatgtttcaacatattttggaggtttttatg 36183408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 696 - 764
Target Start/End: Original strand, 32176980 - 32177048
Alignment:
696 ctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttt 764  Q
    |||||||| ||||| ||||  ||  |||||| ||||||||||||||||||||| || ||||||||||||    
32176980 ctatgagtctctcacgcgctatatacggattctaaaatctgaaatattttaacatgttttggaggtttt 32177048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 695 - 750
Target Start/End: Complemental strand, 32177367 - 32177312
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgt 750  Q
    |||||||||||||||  ||||||| ||| ||| ||||||||||||| |||||||||    
32177367 cctatgagtttctcacacgccctattcgtattctaaaatctgaaatgttttaacgt 32177312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 627 - 665
Target Start/End: Original strand, 6830345 - 6830383
Alignment:
627 ttttcaagacaaattttctatttataaatttcttaacca 665  Q
    ||||||||||| |||||||||||||||||| ||||||||    
6830345 ttttcaagacacattttctatttataaattccttaacca 6830383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 695 - 777
Target Start/End: Original strand, 8217116 - 8217198
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    |||| |||||||||  |||||||| ||  ||| ||||||||||||| |||||||||| ||| ||| |||||||| | ||||||    
8217116 cctacgagtttctcgcgcgccctattcaaattctaaaatctgaaatgttttaacgtgtttttgagatttttatggggtgttta 8217198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 699 - 768
Target Start/End: Complemental strand, 13169814 - 13169745
Alignment:
699 tgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||| ||||| ||| || ||||  ||||||| ||||||||| ||||  ||||||||||||||||    
13169814 tgagtttctcgtgcgctctattcagattcaaaaatctaaaatattttgacgtattttggaggtttttatg 13169745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 627 - 692
Target Start/End: Original strand, 35290714 - 35290779
Alignment:
627 ttttcaagacaaattttctatttataaatttcttaaccaatgcctctggaacactagttagcaaga 692  Q
    |||| ||||||||||||||| ||||| ||| ||||| || || || ||| ||||||||||||||||    
35290714 tttttaagacaaattttctaattatagattacttaatcattgtctatgggacactagttagcaaga 35290779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.000000000002; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 694 - 804
Target Start/End: Complemental strand, 51474109 - 51474000
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||| |||||| || ||  ||||||||||||||||| |||||||||  |||||  | ||||||| | |||||||| |||||  ||||||    
51474109 ccctatgagtttctcgtgcgccgtattcaaattataaaatctgaaatgttttaacgtcttttggtcg-ttttatggggtgtttacgtcattcggattcta 51474011  T
794 taatccaaact 804  Q
    |||||| ||||    
51474010 taatccgaact 51474000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 695 - 768
Target Start/End: Complemental strand, 32556596 - 32556523
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    ||||||||||||||   || |||| ||||||| |||||||||||||||| ||||||  ||||||||||||||||    
32556596 cctatgagtttctcgcacgtcctattcggattttaaaatctgaaatattgtaacgtattttggaggtttttatg 32556523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 695 - 767
Target Start/End: Complemental strand, 17339824 - 17339752
Alignment:
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttat 767  Q
    ||||| ||||||||||  |||||| || |||| ||||||||||||||||| || ||| |||||||||||||||    
17339824 cctatcagtttctcatatgccctattcagattctaaaatctgaaatatttaaatgtgttttggaggtttttat 17339752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 713 - 823
Target Start/End: Original strand, 563821 - 563931
Alignment:
713 gccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaa 812  Q
    |||||| ||| ||| |||||| |||||||| |||||||| ||| |||| ||||||  | |||||| | |||| |||||||||||| | ||||| ||||      
563821 gccctagtcgaattctaaaatttgaaatatgttaacgtgtttttgaggattttatagggtgtttatgtcatttaaattctataattcgaactgtataggt 563920  T
813 cgcgcgagaaa 823  Q
    |||||||||||    
563921 cgcgcgagaaa 563931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 715 - 767
Target Start/End: Original strand, 48400944 - 48400996
Alignment:
715 cctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttat 767  Q
    |||| ||||||| ||||||| ||||| |||||||||| |||||||||||||||    
48400944 cctattcggattctaaaatccgaaatgttttaacgtgttttggaggtttttat 48400996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000002; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 696 - 843
Target Start/End: Original strand, 38303265 - 38303413
Alignment:
696 ctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctat 794  Q
    |||||||||||||  || | ||| ||||||  ||||||||||||| ||| || | | ||| |||||||||||| | || |||| ||| ||   |||||||    
38303265 ctatgagtttctcgcgcactctattcggatcttaaaatctgaaatgtttcaatgcgtttttggaggtttttatacaatatttatgccgtttgtattctat 38303364  T
795 aatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaa 843  Q
    ||||| |||| ||||||||||| |||||| |||||| |||| |||||||    
38303365 aatccgaacttcatagaacgcgtgagaaactcataatgtgaaaaaagaa 38303413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 694 - 797
Target Start/End: Original strand, 39791211 - 39791314
Alignment:
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    |||||| ||||||||||||| |||| | | ||| ||||||| ||||||||| |||||| |||| || |||||||| | |||||| ||| |||  ||||||    
39791211 ccctataagtttctcatgcgtcctatttgaattctaaaatccgaaatatttcaacgtgttttgaagatttttatggggtgtttatgccgttcggattcta 39791310  T
794 taat 797  Q
    ||||    
39791311 taat 39791314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 728 - 824
Target Start/End: Complemental strand, 9689525 - 9689429
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    ||||||||||||||||||||| || ||| ||| || ||||| | ||||||  || |||  ||| ||||||| ||||| |||||| ||||||||||||    
9689525 taaaatctgaaatattttaacttgttttagagattcttatgaggtgtttataccgttcggattatataatctaaactacatagagcgcgcgagaaat 9689429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 627 - 665
Target Start/End: Complemental strand, 45921375 - 45921337
Alignment:
627 ttttcaagacaaattttctatttataaatttcttaacca 665  Q
    |||||||||||||||||||||||||| ||| ||||||||    
45921375 ttttcaagacaaattttctatttatagattccttaacca 45921337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0071 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0071
Description:

Target: scaffold0071; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 728 - 809
Target Start/End: Complemental strand, 125 - 44
Alignment:
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcata 809  Q
    ||||||||||||||||| |||||| ||| |||||||||||| | |||||| ||| ||   |||||||||| | |||||||||    
125 taaaatctgaaatatttaaacgtgttttagaggtttttatggggtgtttatgccgtttggattctataattcgaactgcata 44  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216687 times since January 2019
Visitors: 2908