View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-4 (Length: 1004)

Name: NF4429-Insertion-4
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-4
[»] chr7 (6 HSPs)
chr7 (8-1004)||(35424669-35425672)
chr7 (703-812)||(4332812-4332921)
chr7 (703-812)||(4337059-4337168)
chr7 (699-810)||(35356356-35356466)
chr7 (722-829)||(17115921-17116029)
chr7 (697-844)||(22713371-22713518)
[»] chr2 (6 HSPs)
chr2 (694-844)||(24510905-24511055)
chr2 (694-766)||(43050123-43050195)
chr2 (701-764)||(28816184-28816247)
chr2 (774-833)||(33928060-33928118)
chr2 (722-768)||(19572605-19572651)
chr2 (697-798)||(37267725-37267826)
[»] chr6 (9 HSPs)
chr6 (694-804)||(18075514-18075624)
chr6 (697-829)||(31596495-31596628)
chr6 (695-823)||(9540502-9540630)
chr6 (723-810)||(9929334-9929421)
chr6 (724-834)||(30525782-30525893)
chr6 (695-768)||(33240882-33240954)
chr6 (728-824)||(2396756-2396852)
chr6 (720-813)||(2119215-2119309)
chr6 (695-777)||(2513100-2513182)
[»] chr3 (8 HSPs)
chr3 (715-824)||(44053393-44053502)
chr3 (728-810)||(22318230-22318312)
chr3 (700-777)||(51715027-51715104)
chr3 (695-844)||(26665426-26665576)
chr3 (753-823)||(42110937-42111007)
chr3 (728-809)||(15462067-15462148)
chr3 (741-823)||(39745518-39745598)
chr3 (753-844)||(53852039-53852129)
[»] chr8 (7 HSPs)
chr8 (694-829)||(37507547-37507682)
chr8 (736-824)||(37325135-37325223)
chr8 (711-798)||(40899652-40899740)
chr8 (695-768)||(40506625-40506699)
chr8 (694-810)||(27157658-27157774)
chr8 (627-670)||(40607375-40607418)
chr8 (788-829)||(13818847-13818888)
[»] chr5 (10 HSPs)
chr5 (728-829)||(28503210-28503311)
chr5 (728-829)||(22017653-22017755)
chr5 (723-831)||(18401251-18401360)
chr5 (695-768)||(36183335-36183408)
chr5 (696-764)||(32176980-32177048)
chr5 (695-750)||(32177312-32177367)
chr5 (627-665)||(6830345-6830383)
chr5 (695-777)||(8217116-8217198)
chr5 (699-768)||(13169745-13169814)
chr5 (627-692)||(35290714-35290779)
[»] chr1 (5 HSPs)
chr1 (694-804)||(51474000-51474109)
chr1 (695-768)||(32556523-32556596)
chr1 (695-767)||(17339752-17339824)
chr1 (713-823)||(563821-563931)
chr1 (715-767)||(48400944-48400996)
[»] chr4 (4 HSPs)
chr4 (696-843)||(38303265-38303413)
chr4 (694-797)||(39791211-39791314)
chr4 (728-824)||(9689429-9689525)
chr4 (627-665)||(45921337-45921375)
[»] scaffold0071 (1 HSPs)
scaffold0071 (728-809)||(44-125)

Alignment Details
Target: chr7 (Bit Score: 754; Significance: 0; HSPs: 6)
Name: chr7

Target: chr7; HSP #1
Raw Score: 754; E-Value: 0
Query Start/End: Original strand, 8 - 1004
Target Start/End: Complemental strand, 35425672 - 35424669
8 actttgttataatactttttaaaatatatgatcagatgacactatcagtgcatagttcttaaaccctgatatattttgatattaaaatcattgagtatcc 107  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35425672 actttgttataatactttataaaatatatgatcagatgacactatcagtgcatagttcttaaaccctgatatattttgatattaaaatcattgagtatcc 35425573  T
108 caacctatcatacattcttgaacactacttactaagaacaaacctttcacatctcgtctcatacacttttgctttattgggagcattagtcctattttga 207  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
35425572 caacctatcatacattcttgaacactagttactaagaacaaacctttcacatcttgtctcatacacttttgctttcttgggagcattagtcctattttga 35425473  T
208 aatgaactttttaaaacactttctgtagacacttttgatgtaagtgctcttagcaaaattacaggtccccnnnnnnnn-----ctttattatgtgcttgt 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||             |||||||||||||||||    
35425472 aatgaactttttaaaacactttctgtagacacttttgatgtaagtgctcttagcataattacaggtcccctttttttctttttctttattatgtgcttgt 35425373  T
303 caccttactggccttgttattttcattgttggctcagcgtgccatgtagaaacaaaacaacaggtaacttctacttattttagattaacatatgtagtgt 402  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35425372 caccttactggccttgttattttcattgttggcttagcgtgccatgtagaaacaaaacaacaggtaacttctacttattttagattaacatatgtagtgt 35425273  T
403 acatgagtgatttgaannnnnnngaattcaacaatctttatatattatactcttaaataccaaatttcattatttaagtaacatagatacatatactttt 502  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
35425272 acatgagtgatttgaatttttttgaattcaacaatctttatatattatactcttaaataccaaatttcattatttaagtaacatatatacatatactttt 35425173  T
503 tacgatttatttagatagatgttaaccggtgccctacagacattggttaagcaactaaaacaaacnnnnnnnnnnttaataaaaagtagtgtagtcgtta 602  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||    
35425172 tacgatttatttagatagatgttaaccggtgctctacagacattggttaagcaactaaaacaaacaaaaaaaaa-ttaataaaaagtagtgtagtcgtta 35425074  T
603 cttggtcaaatgcctagcttacacttttcaagacaaattttctatttataaatttcttaaccaatgcctctggaacactagttagcaagagccctatgag 702  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||| ||||||||||| ||||||||    
35425073 cttggtcaaatgcctaacttacacttttcaagacaaaatttctatttataaatttcttaaccaa-gtctctggaacactggttagcaagagtcctatgag 35424975  T
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||| ||||||||||||| ||| ||||||||||||||||||||| |  ||||||||||||||||||||||||| ||| |||| |||||||||||||||    
35424974 tttctcgtgcgccctaatcgaattctaaaatctgaaatattttaacatattttggaggtttttatgcgatgtttatgccgttcagattctataatccaaa 35424875  T
803 ctgcatagaacgcgcgagaaattcataaggtgataaaagaaggtatctttatat----atatgttcgaaaaatcgctgcttagcttctctgggctggata 898  Q
    || ||||| |||| ||||||||||||||| ||||||||||||||||||||||||    ||||||||||||||||| ||||||||||||||||||||||||    
35424874 ctacataggacgcacgagaaattcataagatgataaaagaaggtatctttatatatatatatgttcgaaaaatcgatgcttagcttctctgggctggata 35424775  T
899 ggcccactatttcttttggacctacaatgtgtgctaacgtgttgcttaatcactct-ccaaatcttctcagttgatcaatgcaacaagttaattggagga 997  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||    
35424774 ggcccactatttcttttggacctacaatgtgtgctaacgtgttgcttaatcactctcccaaatc-tctcagttgatcaatgaaacaagttaattggagga 35424676  T
998 atgatat 1004  Q
35424675 atgatat 35424669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 703 - 812
Target Start/End: Original strand, 4332812 - 4332921
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||||||| || || ||| ||| ||||||||||||||||||||| |  ||| ||| |||||||   ||||||  ||||||  ||||||||||||||||    
4332812 tttctcatgcaccttattcgtattctaaaatctgaaatattttaacttcttttagagatttttatcgaatgtttttgccattggaattctataatccaaa 4332911  T
803 ctgcatagaa 812  Q
4332912 ttgcatagaa 4332921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 703 - 812
Target Start/End: Original strand, 4337059 - 4337168
703 tttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaa 802  Q
    |||||||||| || || ||| ||| ||||||||||||||||||||| |  ||| ||| |||||||   ||||||  ||||||  ||||||||||||||||    
4337059 tttctcatgcaccttattcgtattctaaaatctgaaatattttaacttcttttagagatttttatcgaatgtttttgccattggaattctataatccaaa 4337158  T
803 ctgcatagaa 812  Q
4337159 ttgcatagaa 4337168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 699 - 810
Target Start/End: Complemental strand, 35356466 - 35356356
699 tgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatc 798  Q
    |||||||||| |||| |||| | | ||| ||||||| ||||| |||||||||| |||||||||||||||| | | |||||| | |||  ||| |||||||    
35356466 tgagtttctcgtgcgtcctatttgaattctaaaatccgaaatgttttaacgtgttttggaggtttttatggggt-tttacgtcgttcggattatataatc 35356368  T
799 caaactgcatag 810  Q
    | ||||||||||    
35356367 cgaactgcatag 35356356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 722 - 829
Target Start/End: Original strand, 17115921 - 17116029
722 ggattataaaatctgaaatattttaacgtgatttggag-gtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgag 820  Q
    ||||| |||||||| |||||||| |||||| ||| ||  ||||||||| | |||||| | | ||| ||||||||||| |||||||| ||| ||| |||||    
17115921 ggattttaaaatctaaaatatttcaacgtgtttttgaaagtttttatggggtgtttatgtcgttcgaattctataatacaaactgcgtaggacgtgcgag 17116020  T
821 aaattcata 829  Q
    ||| |||||    
17116021 aaactcata 17116029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 697 - 844
Target Start/End: Complemental strand, 22713518 - 22713371
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctata 795  Q
    |||||||||||| |||||| || | | ||| ||||||||||||||||| |||||| ||| |||||||||||   | |||||| |||||||  ||| ||||    
22713518 tatgagtttctcgtgcgcc-tatttgaattttaaaatctgaaatatttcaacgtgtttttggaggtttttacagggtgtttatgccattcggattttata 22713420  T
796 atccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    ||| |||||  |||||  ||| |||||| ||||||| ||  ||||||||    
22713419 atctaaactatatagagtgcgtgagaaactcataagatgggaaaagaag 22713371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 2e-24; HSPs: 6)
Name: chr2

Target: chr2; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 694 - 844
Target Start/End: Original strand, 24510905 - 24511055
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    |||||||||||| |||  | ||||| ||||||| ||||||||||||||||| |||||  |||||||||||||||| |||||||| ||| ||  |||||||    
24510905 ccctatgagtttttcacacaccctattcggattttaaaatctgaaatatttaaacgtattttggaggtttttatgggatgtttatgccgtttgaattcta 24511004  T
794 taatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||| | ||||||||||    ||||||||||||||| | ||| ||||||||    
24511005 taattcgaactgcatagggaacgcgagaaattcataggttgaaaaaagaag 24511055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 694 - 766
Target Start/End: Original strand, 43050123 - 43050195
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggttttta 766  Q
    ||||||||||||||    |||| || ||||||| ||||||||||||| ||| |||||| ||||||||||||||    
43050123 ccctatgagtttcttgcacgccttattcggattttaaaatctgaaatgtttcaacgtgttttggaggttttta 43050195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 701 - 764
Target Start/End: Complemental strand, 28816247 - 28816184
701 agtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttt 764  Q
    |||||||| ||||||||| ||  |||||||||| | |||||||| |||||| ||||||||||||    
28816247 agtttctcgtgcgccctattcaaattataaaattttaaatatttcaacgtgttttggaggtttt 28816184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 833
Target Start/End: Original strand, 33928060 - 33928118
774 tttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattcataaggt 833  Q
    |||| |||||||||||||||||||| ||||| ||||| |||||||||||| | |||||||    
33928060 tttatgccattcaaattctataatctaaactacatag-acgcgcgagaaactgataaggt 33928118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 722 - 768
Target Start/End: Original strand, 19572605 - 19572651
722 ggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    ||||| ||||||||||||| |||||||||| |||||| |||||||||    
19572605 ggattttaaaatctgaaatgttttaacgtgttttggaagtttttatg 19572651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 697 - 798
Target Start/End: Original strand, 37267725 - 37267826
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataa 796  Q
    |||||| ||||| || |||||| | ||||| ||||||| |||||||||||||||| |||||  | ||||||| ||| ||||  |  |||| |||||||||    
37267725 tatgagcttctcgtgtgccctatttggattctaaaatccgaaatattttaacgtgttttgggaggttttatgagatttttatacagttcagattctataa 37267824  T
797 tc 798  Q
37267825 tc 37267826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 4e-22; HSPs: 9)
Name: chr6

Target: chr6; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 694 - 804
Target Start/End: Complemental strand, 18075624 - 18075514
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||  ||||| |||||||||| | ||||||   | |||| ||||||    
18075624 ccctatgagtttctcatgcgccctattcaaattataaaatctgaaatattttaacgtcttttggtggtttttatggggtgtttatttcgttcagattcta 18075525  T
794 taatccaaact 804  Q
    |||||| ||||    
18075524 taatccgaact 18075514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 697 - 829
Target Start/End: Complemental strand, 31596628 - 31596495
697 tatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctata 795  Q
    |||||||||||  ||||||||| ||| ||| ||||||||||||| ||| |||||| ||| ||||| ||||||  | |||||| ||| ||||||||||| |    
31596628 tatgagtttcttgtgcgccctattcgaattttaaaatctgaaatgtttcaacgtgtttttggaggattttattgggtgtttatgccgttcaaattctaca 31596529  T
796 atccaaactgcatagaacgcgcgagaaattcata 829  Q
    ||| |||||| |||| |||||||| ||| |||||    
31596528 atctaaactgtataggacgcgcgaaaaactcata 31596495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 695 - 823
Target Start/End: Complemental strand, 9540630 - 9540502
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctat 794  Q
    ||||||||||||||| |||||||| || |||| ||||||||||||||| ||| |||  |||| ||| ||||||  | |||||| | |||||||||| |||    
9540630 cctatgagtttctcacgcgccctattcagattctaaaatctgaaatatcttaccgttttttgaaggattttatagggtgtttatgtcattcaaattttat 9540531  T
795 aatccaaactgcatagaacgcgcgagaaa 823  Q
    |||  ||||||||||| | |||| |||||    
9540530 aatttaaactgcataggaagcgcaagaaa 9540502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 723 - 810
Target Start/End: Original strand, 9929334 - 9929421
723 gattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatag 810  Q
    |||| ||||||||||||| ||| |||||| |||||||||||||||| | |||||| | | ||| ||||||||||||| ||||||||||    
9929334 gattttaaaatctgaaatctttcaacgtgttttggaggtttttatgaggtgtttatgacgttcgaattctataatccgaactgcatag 9929421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 724 - 834
Target Start/End: Complemental strand, 30525893 - 30525782
724 attataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaa 822  Q
    |||||| |||| ||||| ||| |||||| ||| ||||||||||||| |||||||| ||| |||  ||||||||||||||| |||||||  || |||||||    
30525893 attatagaatccgaaatgtttcaacgtgtttttggaggtttttatgagatgtttatgccgttcggattctataatccaaattgcatagggcgtgcgagaa 30525794  T
823 attcataaggtg 834  Q
    | ||||| ||||    
30525793 actcatagggtg 30525782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 695 - 768
Target Start/End: Complemental strand, 33240954 - 33240882
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||||||| ||||||||| ||||||| ||||||| ||||||||| |||||  |||| |||||||||||    
33240954 cctatgagtttctcgtgcgccctattcggattctaaaatccgaaatatttcaacgt-ttttgaaggtttttatg 33240882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 728 - 824
Target Start/End: Original strand, 2396756 - 2396852
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    |||||||  ||||||||||||||  |||| ||||||||||  | |||||| | ||||| |||||||||||| |||||||||| | |||| |||||||    
2396756 taaaatccaaaatattttaacgtattttgtaggtttttatagggtgtttatgtcattcgaattctataatctaaactgcataaagcgcgtgagaaat 2396852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 720 - 813
Target Start/End: Complemental strand, 2119309 - 2119215
720 tcggattataaaatctgaaatattttaacgtgatttggagg-tttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaac 813  Q
    ||||||| || |||| |||||||||||||||| ||| || | ||||||||  ||||||| | | ||| ||||| |||||||||||||||||||||    
2119309 tcggattctacaatccgaaatattttaacgtgtttttgaagatttttatgaaatgtttatgtctttcgaattccataatccaaactgcatagaac 2119215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 695 - 777
Target Start/End: Original strand, 2513100 - 2513182
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    ||||||||||||||  ||||| || || |||| |||||||  |||| ||||||| |||||||||| |||||||| | ||||||    
2513100 cctatgagtttctctcgcgccttattcagattctaaaatccaaaatgttttaacatgatttggagatttttatgaggtgttta 2513182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 4e-19; HSPs: 8)
Name: chr3

Target: chr3; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 715 - 824
Target Start/End: Original strand, 44053393 - 44053502
715 cctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacg 814  Q
    ||||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||| |||| ||| |||   || |||||||||||||  ||||  ||    
44053393 cctaatcggattataaaatccaaaatattttaacgtgctttggaggtttttatgggatatttatgccgttcgggttatataatccaaactatatagggcg 44053492  T
815 cgcgagaaat 824  Q
44053493 cgcgagaaat 44053502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 728 - 810
Target Start/End: Original strand, 22318230 - 22318312
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatag 810  Q
    |||||| |||||| ||||||| || |||| ||||||||||| |||||||| || |||| ||||||||||||| ||||||||||    
22318230 taaaatatgaaatgttttaacatgttttgaaggtttttatgagatgtttatgctattcgaattctataatccgaactgcatag 22318312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 700 - 777
Target Start/End: Original strand, 51715027 - 51715104
700 gagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    |||||||||  |||||| | ||||||| ||||||||||||| |||||||||| |||||||||||||||| | ||||||    
51715027 gagtttctcgcgcgcccgattcggattctaaaatctgaaatgttttaacgtgttttggaggtttttatggggtgttta 51715104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 695 - 844
Target Start/End: Complemental strand, 26665576 - 26665426
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttg-gaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||  ||| |||| | ||||| ||||||| ||||||||| ||| || |||  ||  |||||||| | |||||| ||| |||  ||||||    
26665576 cctatgagtttctcgcgcgtcctatttggattttaaaatccgaaatatttcaacatgttttccgaaatttttatgggttgtttatgccgttcggattcta 26665477  T
794 taatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||| ||||||||||||  ||||||||||| ||||| ||||  ||||||||    
26665476 taattcaaactgcatagggcgcgcgagaaactcatatggtgggaaaagaag 26665426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 753 - 823
Target Start/End: Complemental strand, 42111007 - 42110937
753 tttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaa 823  Q
    |||||||||||||||| | |||||| | | ||| ||||||||||||||| ||||||||  |||||||||||    
42111007 tttggaggtttttatggggtgtttatgtcgttcgaattctataatccaacctgcatagggcgcgcgagaaa 42110937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 728 - 809
Target Start/End: Original strand, 15462067 - 15462148
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcata 809  Q
    ||||||||||||||||| |||||| ||| |||||||||||| | |||||| ||| ||   |||||||||| | |||||||||    
15462067 taaaatctgaaatatttaaacgtgttttagaggtttttatggggtgtttatgccgtttggattctataattcgaactgcata 15462148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 741 - 823
Target Start/End: Complemental strand, 39745598 - 39745518
741 attttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaa 823  Q
    ||||||||||| ||| ||||||| ||||  ||||||| ||| |||  || ||||||||| ||||||||||||||| |||||||    
39745598 attttaacgtgttttagaggtttatatg--atgtttatgccgttcggatcctataatccgaactgcatagaacgcacgagaaa 39745518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 753 - 844
Target Start/End: Complemental strand, 53852129 - 53852039
753 tttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaag 844  Q
    |||||||||||||||| | | |||| ||||||||||||||||||||| |||| |||||  || || ||||| ||||| ||||  ||||||||    
53852129 tttggaggtttttatggg-tatttatgccattcaaattctataatccgaactacatagggcgagcaagaaactcatacggtgggaaaagaag 53852039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 7)
Name: chr8

Target: chr8; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 694 - 829
Target Start/End: Original strand, 37507547 - 37507682
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||   |||||||| ||| ||| ||||||| ||||| ||| |||||| |||||||||||||||| | | |||| | | |||| ||||||    
37507547 ccctatgagtttcttgcgcgccctattcgaattctaaaatccgaaatgtttcaacgtgttttggaggtttttatggggtatttatgtcgttcagattcta 37507646  T
794 taatccaaactgcatagaacgcgcgagaaattcata 829  Q
    ||| ||||| ||||||| | || ||||||| |||||    
37507647 taaaccaaattgcataggaagcacgagaaactcata 37507682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 736 - 824
Target Start/End: Original strand, 37325135 - 37325223
736 gaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    ||||| |||||||||| |||||||||||| ||| |||||||| | ||||  |||||||||||| ||| ||||||| ||||| |||||||    
37325135 gaaatgttttaacgtgttttggaggttttaatgggatgtttatgtcatttgaattctataatctaaattgcataggacgcgtgagaaat 37325223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 711 - 798
Target Start/End: Original strand, 40899652 - 40899740
711 gcgccctaatcggattataaaatctgaaatattttaacgtg-atttggaggtttttatgcgatgtttacgccattcaaattctataatc 798  Q
    |||||||| || |||| ||||||||||||||||||||||||  |||| ||||||||||| | |||||| ||| ||| |||| |||||||    
40899652 gcgccctattcagattttaaaatctgaaatattttaacgtgtttttgaaggtttttatggggtgtttatgcctttcgaattttataatc 40899740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 695 - 768
Target Start/End: Original strand, 40506625 - 40506699
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtga-tttggaggtttttatg 768  Q
    |||||||||||||| |  |||||| | ||||| ||||||| ||||||||| ||||||| ||||||||||||||||    
40506625 cctatgagtttctcgtatgccctatttggattgtaaaatccgaaatatttcaacgtgattttggaggtttttatg 40506699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 694 - 810
Target Start/End: Complemental strand, 27157774 - 27157658
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||| ||||  ||| ||||||| ||||||| ||| ||||| |||||| ||| |  | ||||||| | | |||| |||||||  ||||||    
27157774 ccctatgagtttctcgtgcgtgctattcggattctaaaatccgaattatttcaacgtggttttggagattttatggggtatttatgccattcggattcta 27157675  T
794 taatccaaactgcatag 810  Q
    |||||| || |||||||    
27157674 taatccgaaatgcatag 27157658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 627 - 670
Target Start/End: Original strand, 40607375 - 40607418
627 ttttcaagacaaattttctatttataaatttcttaaccaatgcc 670  Q
    |||| |||| ||||||||||||||||||||||||||||| ||||    
40607375 tttttaagataaattttctatttataaatttcttaaccattgcc 40607418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 788 - 829
Target Start/End: Original strand, 13818847 - 13818888
788 attctataatccaaactgcatagaacgcgcgagaaattcata 829  Q
    |||||||||||| |||| |||||||||||||||||| |||||    
13818847 attctataatccgaactacatagaacgcgcgagaaactcata 13818888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr5

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 728 - 829
Target Start/End: Complemental strand, 28503311 - 28503210
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattca 827  Q
    ||||||||||||||||| |||||  ||||||||||||||||   | |||| ||| ||| |||| ||||||||||||||||||| ||||| || ||| |||    
28503311 taaaatctgaaatatttcaacgtattttggaggtttttatggagtatttatgccgttcgaattttataatccaaactgcataggacgcgtgaaaaactca 28503212  T
828 ta 829  Q
28503211 ta 28503210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 728 - 829
Target Start/End: Original strand, 22017653 - 22017755
728 taaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaattc 826  Q
    ||||||||||||| ||| |||| | ||| ||||||||||||| | |||||| |||||||  |||||||||||| |||||||||| ||| || ||||| ||    
22017653 taaaatctgaaatgtttcaacgcgtttttggaggtttttatggggtgtttatgccattcggattctataatccgaactgcataggacgtgcaagaaactc 22017752  T
827 ata 829  Q
22017753 ata 22017755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 723 - 831
Target Start/End: Original strand, 18401251 - 18401360
723 gattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgaga 821  Q
    ||||||| |||||||||| ||| |||||| ||| |||||| | |||| | |||||| ||  ||  ||||||||| ||| ||||||||||||||| |||||    
18401251 gattatagaatctgaaatgtttcaacgtgtttttggaggtctgtatgaggtgtttatgctttttgaattctatattccgaactgcatagaacgcacgaga 18401350  T
822 aattcataag 831  Q
    || |||||||    
18401351 aactcataag 18401360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 695 - 768
Target Start/End: Original strand, 36183335 - 36183408
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||||||| |||||| || ||||||| ||||||| ||||| ||| ||| |  ||||||||||||||||    
36183335 cctatgagtttctcgtgcgccatattcggattctaaaatccgaaatgtttcaacatattttggaggtttttatg 36183408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 696 - 764
Target Start/End: Original strand, 32176980 - 32177048
696 ctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttt 764  Q
    |||||||| ||||| ||||  ||  |||||| ||||||||||||||||||||| || ||||||||||||    
32176980 ctatgagtctctcacgcgctatatacggattctaaaatctgaaatattttaacatgttttggaggtttt 32177048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 695 - 750
Target Start/End: Complemental strand, 32177367 - 32177312
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgt 750  Q
    |||||||||||||||  ||||||| ||| ||| ||||||||||||| |||||||||    
32177367 cctatgagtttctcacacgccctattcgtattctaaaatctgaaatgttttaacgt 32177312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 627 - 665
Target Start/End: Original strand, 6830345 - 6830383
627 ttttcaagacaaattttctatttataaatttcttaacca 665  Q
    ||||||||||| |||||||||||||||||| ||||||||    
6830345 ttttcaagacacattttctatttataaattccttaacca 6830383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 695 - 777
Target Start/End: Original strand, 8217116 - 8217198
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgttta 777  Q
    |||| |||||||||  |||||||| ||  ||| ||||||||||||| |||||||||| ||| ||| |||||||| | ||||||    
8217116 cctacgagtttctcgcgcgccctattcaaattctaaaatctgaaatgttttaacgtgtttttgagatttttatggggtgttta 8217198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 699 - 768
Target Start/End: Complemental strand, 13169814 - 13169745
699 tgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    |||||||||| ||||| ||| || ||||  ||||||| ||||||||| ||||  ||||||||||||||||    
13169814 tgagtttctcgtgcgctctattcagattcaaaaatctaaaatattttgacgtattttggaggtttttatg 13169745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 627 - 692
Target Start/End: Original strand, 35290714 - 35290779
627 ttttcaagacaaattttctatttataaatttcttaaccaatgcctctggaacactagttagcaaga 692  Q
    |||| ||||||||||||||| ||||| ||| ||||| || || || ||| ||||||||||||||||    
35290714 tttttaagacaaattttctaattatagattacttaatcattgtctatgggacactagttagcaaga 35290779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.000000000002; HSPs: 5)
Name: chr1

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 694 - 804
Target Start/End: Complemental strand, 51474109 - 51474000
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    ||||||||||||||| |||||| || ||  ||||||||||||||||| |||||||||  |||||  | ||||||| | |||||||| |||||  ||||||    
51474109 ccctatgagtttctcgtgcgccgtattcaaattataaaatctgaaatgttttaacgtcttttggtcg-ttttatggggtgtttacgtcattcggattcta 51474011  T
794 taatccaaact 804  Q
    |||||| ||||    
51474010 taatccgaact 51474000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 695 - 768
Target Start/End: Complemental strand, 32556596 - 32556523
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatg 768  Q
    ||||||||||||||   || |||| ||||||| |||||||||||||||| ||||||  ||||||||||||||||    
32556596 cctatgagtttctcgcacgtcctattcggattttaaaatctgaaatattgtaacgtattttggaggtttttatg 32556523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 695 - 767
Target Start/End: Complemental strand, 17339824 - 17339752
695 cctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttat 767  Q
    ||||| ||||||||||  |||||| || |||| ||||||||||||||||| || ||| |||||||||||||||    
17339824 cctatcagtttctcatatgccctattcagattctaaaatctgaaatatttaaatgtgttttggaggtttttat 17339752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 713 - 823
Target Start/End: Original strand, 563821 - 563931
713 gccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaa 812  Q
    |||||| ||| ||| |||||| |||||||| |||||||| ||| |||| ||||||  | |||||| | |||| |||||||||||| | ||||| ||||      
563821 gccctagtcgaattctaaaatttgaaatatgttaacgtgtttttgaggattttatagggtgtttatgtcatttaaattctataattcgaactgtataggt 563920  T
813 cgcgcgagaaa 823  Q
563921 cgcgcgagaaa 563931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 715 - 767
Target Start/End: Original strand, 48400944 - 48400996
715 cctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttat 767  Q
    |||| ||||||| ||||||| ||||| |||||||||| |||||||||||||||    
48400944 cctattcggattctaaaatccgaaatgttttaacgtgttttggaggtttttat 48400996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000002; HSPs: 4)
Name: chr4

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 696 - 843
Target Start/End: Original strand, 38303265 - 38303413
696 ctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgattt-ggaggtttttatgcgatgtttacgccattcaaattctat 794  Q
    |||||||||||||  || | ||| ||||||  ||||||||||||| ||| || | | ||| |||||||||||| | || |||| ||| ||   |||||||    
38303265 ctatgagtttctcgcgcactctattcggatcttaaaatctgaaatgtttcaatgcgtttttggaggtttttatacaatatttatgccgtttgtattctat 38303364  T
795 aatccaaactgcatagaacgcgcgagaaattcataaggtgataaaagaa 843  Q
    ||||| |||| ||||||||||| |||||| |||||| |||| |||||||    
38303365 aatccgaacttcatagaacgcgtgagaaactcataatgtgaaaaaagaa 38303413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 694 - 797
Target Start/End: Original strand, 39791211 - 39791314
694 ccctatgagtttctcatgcgccctaatcggattataaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattcta 793  Q
    |||||| ||||||||||||| |||| | | ||| ||||||| ||||||||| |||||| |||| || |||||||| | |||||| ||| |||  ||||||    
39791211 ccctataagtttctcatgcgtcctatttgaattctaaaatccgaaatatttcaacgtgttttgaagatttttatggggtgtttatgccgttcggattcta 39791310  T
794 taat 797  Q
39791311 taat 39791314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 728 - 824
Target Start/End: Complemental strand, 9689525 - 9689429
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcatagaacgcgcgagaaat 824  Q
    ||||||||||||||||||||| || ||| ||| || ||||| | ||||||  || |||  ||| ||||||| ||||| |||||| ||||||||||||    
9689525 taaaatctgaaatattttaacttgttttagagattcttatgaggtgtttataccgttcggattatataatctaaactacatagagcgcgcgagaaat 9689429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 627 - 665
Target Start/End: Complemental strand, 45921375 - 45921337
627 ttttcaagacaaattttctatttataaatttcttaacca 665  Q
    |||||||||||||||||||||||||| ||| ||||||||    
45921375 ttttcaagacaaattttctatttatagattccttaacca 45921337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0071 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0071

Target: scaffold0071; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 728 - 809
Target Start/End: Complemental strand, 125 - 44
728 taaaatctgaaatattttaacgtgatttggaggtttttatgcgatgtttacgccattcaaattctataatccaaactgcata 809  Q
    ||||||||||||||||| |||||| ||| |||||||||||| | |||||| ||| ||   |||||||||| | |||||||||    
125 taaaatctgaaatatttaaacgtgttttagaggtttttatggggtgtttatgccgtttggattctataattcgaactgcata 44  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109734 times since January 2019
Visitors: 1349