View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-7 (Length: 744)

Name: NF4429-Insertion-7
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-7
NF4429-Insertion-7
[»] chr5 (1 HSPs)
chr5 (6-744)||(13715076-13715803)


Alignment Details
Target: chr5 (Bit Score: 544; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 544; E-Value: 0
Query Start/End: Original strand, 6 - 744
Target Start/End: Complemental strand, 13715803 - 13715076
Alignment:
6 cattggcttcactctatggatggggatttgtccaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttgaaatgcc 105  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
13715803 cattggcttcactctatggatggggatttgtctaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttggaatgcc 13715704  T
106 tttgtccccaccccccacatnnnnnnnnnnnnnnnntcgggccttcatttgtttggagattggctcatcataagcttctaactaatgaccagttacgaat 205  Q
    ||||||||||||||||||||                ||||||||||||||||||  |||||||||||||| |||||||||||| ||||||||||||||||    
13715703 tttgtccccaccccccacatacacacacacacac--tcgggccttcatttgtttaaagattggctcatcaaaagcttctaactgatgaccagttacgaat 13715606  T
206 aagagggtgtattttggtctccgcttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctc 305  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13715605 aagagggtgtattttggtctctgtttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctc 13715506  T
306 agcaacaatataaatcaacctctcgacctatcatcttgggatattccgctgcattgctcgtagaatgtttggagccctccagtgaaacaaatcatgcttt 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
13715505 agcaacaatataaatcaacctctcgacctatcatcttgggatattccgctacattgctcgtagaatgtttggagccctccagtgaaacaaatcatgcttt 13715406  T
406 ctgccaagcttcatactatttggattatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttat 505  Q
    ||||||||||||||         |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13715405 ctgccaagcttcat---------attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttat 13715315  T
506 ttatgaagttcatcttagttgcaatcttattaaaggtcgtggttcatcttc--tatggtagatttttgtgttacccaactgttcaaaacctcttgcagtg 603  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||    
13715314 ttatgaagttcatcttagctgcaatcttattaaaggtcgtggttcatcttctatatggtagacttttgtgttacccaactgttcaaaacctcttgcagtg 13715215  T
604 cgtctattcctcactcgttttttgaagttgtttggtcccctccttgcccggttgggtcaagtttaacctggatggatctatggtggctaannnnnnnaag 703  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||        ||    
13715214 cgtctattccttactcgttttttgaagttgtttggtcccctccttgcctggttgggtcaagtttaatctggatggatctatggtgggtaacccccc--ag 13715117  T
704 tttgccactattggaattgcttgtagagatagtaatgctca 744  Q
    | ||| |||||||||||||||||||||||||||||||||||    
13715116 tctgctactattggaattgcttgtagagatagtaatgctca 13715076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 30159 times since January 2019
Visitors: 1588