View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-7 (Length: 744)

Name: NF4429-Insertion-7
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-7
[»] chr5 (1 HSPs)
chr5 (6-744)||(13715076-13715803)

Alignment Details
Target: chr5 (Bit Score: 544; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 544; E-Value: 0
Query Start/End: Original strand, 6 - 744
Target Start/End: Complemental strand, 13715803 - 13715076
6 cattggcttcactctatggatggggatttgtccaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttgaaatgcc 105  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
13715803 cattggcttcactctatggatggggatttgtctaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttggaatgcc 13715704  T
106 tttgtccccaccccccacatnnnnnnnnnnnnnnnntcgggccttcatttgtttggagattggctcatcataagcttctaactaatgaccagttacgaat 205  Q
    ||||||||||||||||||||                ||||||||||||||||||  |||||||||||||| |||||||||||| ||||||||||||||||    
13715703 tttgtccccaccccccacatacacacacacacac--tcgggccttcatttgtttaaagattggctcatcaaaagcttctaactgatgaccagttacgaat 13715606  T
206 aagagggtgtattttggtctccgcttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctc 305  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13715605 aagagggtgtattttggtctctgtttgttgcttctgctatatgacagctgagcacattatttttaattgctctgtcacctcacaattttggaattggctc 13715506  T
306 agcaacaatataaatcaacctctcgacctatcatcttgggatattccgctgcattgctcgtagaatgtttggagccctccagtgaaacaaatcatgcttt 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
13715505 agcaacaatataaatcaacctctcgacctatcatcttgggatattccgctacattgctcgtagaatgtttggagccctccagtgaaacaaatcatgcttt 13715406  T
406 ctgccaagcttcatactatttggattatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttat 505  Q
    ||||||||||||||         |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13715405 ctgccaagcttcat---------attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttat 13715315  T
506 ttatgaagttcatcttagttgcaatcttattaaaggtcgtggttcatcttc--tatggtagatttttgtgttacccaactgttcaaaacctcttgcagtg 603  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||    
13715314 ttatgaagttcatcttagctgcaatcttattaaaggtcgtggttcatcttctatatggtagacttttgtgttacccaactgttcaaaacctcttgcagtg 13715215  T
604 cgtctattcctcactcgttttttgaagttgtttggtcccctccttgcccggttgggtcaagtttaacctggatggatctatggtggctaannnnnnnaag 703  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||        ||    
13715214 cgtctattccttactcgttttttgaagttgtttggtcccctccttgcctggttgggtcaagtttaatctggatggatctatggtgggtaacccccc--ag 13715117  T
704 tttgccactattggaattgcttgtagagatagtaatgctca 744  Q
    | ||| |||||||||||||||||||||||||||||||||||    
13715116 tctgctactattggaattgcttgtagagatagtaatgctca 13715076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175383 times since January 2019
Visitors: 2677