View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-8 (Length: 694)

Name: NF4429-Insertion-8
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429-Insertion-8
NF4429-Insertion-8
[»] chr7 (2 HSPs)
chr7 (8-694)||(39178166-39178853)
chr7 (130-691)||(39181358-39181909)


Alignment Details
Target: chr7 (Bit Score: 635; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 635; E-Value: 0
Query Start/End: Original strand, 8 - 694
Target Start/End: Complemental strand, 39178853 - 39178166
Alignment:
8 cactcattcactcacatttggatttctaaaatttccttcctcgagtaaggcaatagttcatggtaatgaaattgacggggtgtatcacttgacttgtatt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39178853 cactcattcactcacatttggatttctaaaatttccttcctcgagtaaggcaatagttcatggtaatgaaattgacggggtgtatcacttgacttgtatt 39178754  T
108 aagaatttttgaacagcctaattctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgcagca 207  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||     
39178753 aagaatttttaaacagcctaattctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgtagct 39178654  T
208 actgaaaatgcaacattgtaagttgtaattgtagttatctaggagttgccgcatatacctttttaccataaatataattcacaaagactcaccttcaaac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
39178653 actgaaaatgcaacattgtaagttgtaattgtagttatctaggagttgtcgcatatacctttttaccataaatataattcacaaagactcaccttcaaac 39178554  T
308 tctccctaacccttaaaaatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccac 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39178553 tctccctaacccttaaaaatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccac 39178454  T
408 gctaacaacttatgggatgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattct 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39178453 gctaacaacttatgggatgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattct 39178354  T
508 cctatgctgtattgaatttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattaatca 607  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
39178353 cctatgttgtattgaatttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattagtca 39178254  T
608 acacacgacccatggttttctacaattcaagtattacactt-nnnnnnnttggatttagtatgctacctatctttcgtgattatacag 694  Q
    |||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||    
39178253 acacacgacccatggttttctacaattcaagtattacacttaaaaaaaattggatttagtatgctacctatctttcgtgattatacag 39178166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 130 - 691
Target Start/End: Complemental strand, 39181909 - 39181358
Alignment:
130 tctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgcagcaactgaaaatgcaac-attgtaa 228  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |    ||||||| ||||||||| |||||||    
39181909 tctatatgctgaataagctagacgcatagtttcaaataggagttgcaatcacagatgtgattgtggctgaa----gcaactgcaaatgcaaccattgtaa 39181814  T
229 gttgt---aattgtagttatctaggagttgccgcatatacctttttaccataaatataattcacaaagactcaccttcaa-actctccctaacccttaaa 324  Q
    |||||   || ||||||||||||| ||||| ||||||  | ||||||||||||||||||||||||||        || || |||| || ||||| |||||    
39181813 gttgttgtaactgtagttatctag-agttgtcgcatac-cttttttaccataaatataattcacaaa--------ttaaatactcaccttaacctttaaa 39181724  T
325 aatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccacgctaacaacttatggga 424  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||     
39181723 aatgtttatatcagacaaccctttagcttgggatataaatcagtttggtta--gtttgcttaacaacatgaattatgatccacgctaacaacttatgggg 39181626  T
425 tgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattctcctatgctgtattgaat 524  Q
    || ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||| ||||||||    
39181625 tgctaaaccacaacaactcaacaacaaacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttaccttctcttgtgctttattgaat 39181526  T
525 ttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattaatcaacacacgacccatggtt 624  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||    
39181525 ttactcattctgatcattgtcagatattatcttttgcacgtggatttcaagcacattttttgttttctacatattattaatcaacacacgacccatggtt 39181426  T
625 ttctacaattcaagtattacacttnnnnnnntt-ggatttagtatgctacctatctttcgtgattata 691  Q
    |||||||||||||||||||| |||       || |||||||| |||||||||||||| ||||||||||    
39181425 ttctacaattcaagtattacgcttaaaaaaattgggatttagaatgctacctatcttacgtgattata 39181358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191948 times since January 2019
Visitors: 2831