View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429-Insertion-8 (Length: 694)

Name: NF4429-Insertion-8
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429-Insertion-8
[»] chr7 (2 HSPs)
chr7 (8-694)||(39178166-39178853)
chr7 (130-691)||(39181358-39181909)

Alignment Details
Target: chr7 (Bit Score: 635; Significance: 0; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 635; E-Value: 0
Query Start/End: Original strand, 8 - 694
Target Start/End: Complemental strand, 39178853 - 39178166
8 cactcattcactcacatttggatttctaaaatttccttcctcgagtaaggcaatagttcatggtaatgaaattgacggggtgtatcacttgacttgtatt 107  Q
39178853 cactcattcactcacatttggatttctaaaatttccttcctcgagtaaggcaatagttcatggtaatgaaattgacggggtgtatcacttgacttgtatt 39178754  T
108 aagaatttttgaacagcctaattctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgcagca 207  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||     
39178753 aagaatttttaaacagcctaattctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgtagct 39178654  T
208 actgaaaatgcaacattgtaagttgtaattgtagttatctaggagttgccgcatatacctttttaccataaatataattcacaaagactcaccttcaaac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
39178653 actgaaaatgcaacattgtaagttgtaattgtagttatctaggagttgtcgcatatacctttttaccataaatataattcacaaagactcaccttcaaac 39178554  T
308 tctccctaacccttaaaaatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccac 407  Q
39178553 tctccctaacccttaaaaatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccac 39178454  T
408 gctaacaacttatgggatgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattct 507  Q
39178453 gctaacaacttatgggatgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattct 39178354  T
508 cctatgctgtattgaatttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattaatca 607  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
39178353 cctatgttgtattgaatttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattagtca 39178254  T
608 acacacgacccatggttttctacaattcaagtattacactt-nnnnnnnttggatttagtatgctacctatctttcgtgattatacag 694  Q
    |||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||    
39178253 acacacgacccatggttttctacaattcaagtattacacttaaaaaaaattggatttagtatgctacctatctttcgtgattatacag 39178166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 130 - 691
Target Start/End: Complemental strand, 39181909 - 39181358
130 tctatatgctgaataagctagacccatagtttcaaatagaagttgcaatcacagatgtgattgtggctgcacgcagcaactgaaaatgcaac-attgtaa 228  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |    ||||||| ||||||||| |||||||    
39181909 tctatatgctgaataagctagacgcatagtttcaaataggagttgcaatcacagatgtgattgtggctgaa----gcaactgcaaatgcaaccattgtaa 39181814  T
229 gttgt---aattgtagttatctaggagttgccgcatatacctttttaccataaatataattcacaaagactcaccttcaa-actctccctaacccttaaa 324  Q
    |||||   || ||||||||||||| ||||| ||||||  | ||||||||||||||||||||||||||        || || |||| || ||||| |||||    
39181813 gttgttgtaactgtagttatctag-agttgtcgcatac-cttttttaccataaatataattcacaaa--------ttaaatactcaccttaacctttaaa 39181724  T
325 aatgtttatatcagacaaccctttaacttgggatataaatcagtttggttatagttttcttaacaacatgaattatgatccacgctaacaacttatggga 424  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||     
39181723 aatgtttatatcagacaaccctttagcttgggatataaatcagtttggtta--gtttgcttaacaacatgaattatgatccacgctaacaacttatgggg 39181626  T
425 tgataaaccacaacaagtcaacaacagacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttacattctcctatgctgtattgaat 524  Q
    || ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||| ||||||||    
39181625 tgctaaaccacaacaactcaacaacaaacttaataatacatcttgacccagaaattcaagtatctgatgcatgtttaccttctcttgtgctttattgaat 39181526  T
525 ttactcattctgatcattgtcggatattatcttttgcacttggatttcaagcacattttttgttttctaaatatcattaatcaacacacgacccatggtt 624  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||    
39181525 ttactcattctgatcattgtcagatattatcttttgcacgtggatttcaagcacattttttgttttctacatattattaatcaacacacgacccatggtt 39181426  T
625 ttctacaattcaagtattacacttnnnnnnntt-ggatttagtatgctacctatctttcgtgattata 691  Q
    |||||||||||||||||||| |||       || |||||||| |||||||||||||| ||||||||||    
39181425 ttctacaattcaagtattacgcttaaaaaaattgggatttagaatgctacctatcttacgtgattata 39181358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 115991 times since January 2019
Visitors: 1394