View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429_high_4 (Length: 217)

Name: NF4429_high_4
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF4429_high_4
[»] chr3 (1 HSPs)
chr3 (1-217)||(50048360-50048576)

Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 50048360 - 50048576
1 aattgttcagccattgcttgtcctattaaacaaaactgcaggtaaatctaggagacaaaaatcaagacagagtgaagtaactatttggtgtcaagataaa 100  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
50048360 aattgttcagccattgcttgtcctattaaacaaaactgaaagtaaatctaggagacaaaaatcaagacagagtgaagtaactatttagtgtcaagataaa 50048459  T
101 agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact 200  Q
50048460 agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact 50048559  T
201 tgattaaactaaattta 217  Q
50048560 tgattaaactaaattta 50048576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 216845 times since January 2019
Visitors: 2908